Sonic Hedgehog (SHH) (NM_000193) Human Untagged Clone

SKU
SC300021
SHH (untagged)-Human sonic hedgehog (SHH)
$686.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Sonic Hedgehog
Synonyms HHG1; HLP3; HPE3; MCOPCB5; ShhNC; SMMCI; TPT; TPTPS
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_000193 edited
ATGGGCGAGATGCTGCTGCTGGCGAGATGTCTGCTGCTAGTCCTCGTCTCCTCGCTGCTG
GTATGCTCGGGACTGGCGTGCGGACCGGGCAGGGGGTTCGGGAAGAGGAGGCACCCCAAA
AAGCTGACCCCTTTAGCCTACAAGCAGTTTATCCCCAATGTGGCCGAGAAGACCCTAGGC
GCCAGCGGAAGGTATGAAGGGAAGATCTCCAGAAACTCCGAGCGATTTAAGGAACTCACC
CCCAATTACAACCCCGACATCATATTTAAGGATGAAGAAAACACCGGAGCGGACAGGCTG
ATGACTCAGAGGTGTAAGGACAAGTTGAACGCTTTGGCCATCTCGGTGATGAACCAGTGG
CCAGGAGTGAAACTGCGGGTGACCGAGGGCTGGGACGAAGATGGCCACCACTCAGAGGAG
TCTCTGCACTACGAGGGCCGCGCAGTGGACATCACCACGTCTGACCGCGACCGCAGCAAG
TACGGCATGCTGGCCCGCCTGGCGGTGGAGGCCGGCTTCGACTGGGTGTACTACGAGTCC
AAGGCACATATCCACTGCTCGGTGAAAGCAGAGAACTCGGTGGCGGCCAAATCGGGAGGC
TGCTTCCCGGGCTCGGCCACGGTGCACCTGGAGCAGGGCGGCACCAAGCTGGTGAAGGAC
CTGAGCCCCGGGGACCGCGTGCTGGCGGCGGACGACCAGGGCCGGCTGCTCTACAGCGAC
TTCCTCACTTTCCTGGACCGCGACGACGGCGCCAAGAAGGTCTTCTACGTGATCGAGACG
CGGGAGCCGCGCGAGCGCCTGCTGCTCACCGCCGCGCACCTGCTCTTTGTGGCGCCGCAC
AACGACTCGGCCACCGGGGAGCCCGAGGCGTCCTCGGGCTCGGGGCCGCCTTCCGGGGGC
GCACTGGGGCCTCGGGCGCTGTTCGCCAGCCGCGTGCGCCCGGGCCAGCGCGTGTACGTG
GTGGCCGAGCGTGACGGGGACCGCCGGCTCCTGCCCGCCGCTGTGCACAGCGTGACCCTA
AGCGAGGAGGCCGCGGGCGCCTACGCGCCGCTCACGGCCCAGGGCACCATTCTCATCAAC
CGGGTGCTGGCCTCGTGCTACGCGGTCATCGAGGAGCACAGCTGGGCGCACCGGGCCTTC
GCGCCCTTCCGCCTGGCGCACGCGCTCCTGGCTGCACTGGCGCCCGCGCGCACGGACCGC
GGCGGGGACAGCGGCGGCGGGGACCGCGGGGGCGGCGGCGGCAGAGTAGCCCTAACCGCT
CCAGGTGCTGCCGACGCTCCGGGTGCGGGGGCCACCGCGGGCATCCACTGGTACTCGCAG
CTGCTCTACCAAATAGGCACCTGGCTCCTGGACAGCGAGGCCCTGCACCCGCTGGGCATG
GCGGTCAAGTCCAGCTGA
Restriction Sites Please inquire
ACCN NM_000193
Insert Size 1400 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_000193.2, NP_000184.1
RefSeq Size 1576 bp
RefSeq ORF 1389 bp
Locus ID 6469
UniProt ID Q15465
Cytogenetics 7q36.3
Protein Families Druggable Genome, ES Cell Differentiation/IPS, Secreted Protein, Transmembrane
Protein Pathways Basal cell carcinoma, Hedgehog signaling pathway, Pathways in cancer
Summary This gene encodes a protein that is instrumental in patterning the early embryo. It has been implicated as the key inductive signal in patterning of the ventral neural tube, the anterior-posterior limb axis, and the ventral somites. Of three human proteins showing sequence and functional similarity to the sonic hedgehog protein of Drosophila, this protein is the most similar. The protein is made as a precursor that is autocatalytically cleaved; the N-terminal portion is soluble and contains the signalling activity while the C-terminal portion is involved in precursor processing. More importantly, the C-terminal product covalently attaches a cholesterol moiety to the N-terminal product, restricting the N-terminal product to the cell surface and preventing it from freely diffusing throughout the developing embryo. Defects in this protein or in its signalling pathway are a cause of holoprosencephaly (HPE), a disorder in which the developing forebrain fails to correctly separate into right and left hemispheres. HPE is manifested by facial deformities. It is also thought that mutations in this gene or in its signalling pathway may be responsible for VACTERL syndrome, which is characterized by vertebral defects, anal atresia, tracheoesophageal fistula with esophageal atresia, radial and renal dysplasia, cardiac anomalies, and limb abnormalities. Additionally, mutations in a long range enhancer located approximately 1 megabase upstream of this gene disrupt limb patterning and can result in preaxial polydactyly. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (1).
Write Your Own Review
You're reviewing:Sonic Hedgehog (SHH) (NM_000193) Human Untagged Clone
Your Rating
SKU Description Size Price
RC222175 SHH (Myc-DDK-tagged)-Human sonic hedgehog (SHH) 10 ug
$686.00
RC222175L1 Lenti ORF clone of Human sonic hedgehog (SHH), Myc-DDK-tagged 10 ug
$986.00
RC222175L2 Lenti ORF clone of Human sonic hedgehog (SHH), mGFP tagged 10 ug
$986.00
RC222175L3 Lenti ORF clone of Human sonic hedgehog (SHH), Myc-DDK-tagged 10 ug
$986.00
RC222175L4 Lenti ORF clone of Human sonic hedgehog (SHH), mGFP tagged 10 ug
$986.00
RG222175 SHH (tGFP-tagged) - Human sonic hedgehog (SHH) 10 ug
$886.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.