Galactoside 2 alpha L fucosyltransferase 1 (FUT1) (NM_000148) Human Untagged Clone
SKU
SC300016
FUT1 (untagged)-Human fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, H blood group) (FUT1)
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | Galactoside 2 alpha L fucosyltransferase 1 |
Synonyms | H; HH; HSC |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
Fully Sequenced ORF
>OriGene sequence for NM_000148 edited
AAAAGCGGACTGTGGATCTGCCACCTGCAAGCAGCTCGGCCATGTGGCTCCGGAGCCATC GTCAGCTCTGCCTGGCCTTCCTGCTAGTCTGTGTCCTCTCTGTAATCTTCTTCCTCCATA TCCATCAAGACAGCTTTCCACATGGCCTAGGCCTGTCGATCCTGTGTCCAGACCGCCGCC TGGTGACACCCCCAGTGGCCATCTTCTGCCTGCCGGGTACTGCGATGGGCCCCAACGCCT CCTCTTCCTGTCCCCAGCACCCTGCTTCCCTCTCCGGCACCTGGACTGTCTACCCCAATG GCCGGTTTGGTAATCAGATGGGACAGTATGCCACGCTGCTGGCTCTGGCCCAGCTCAACG GCCGCCGGGCCTTTATCCTGCCTGCCATGCATGCCGCCCTGGCCCCGGTATTCCGCATCA CCCTGCCCGTGCTGGCCCCAGAAGTGGACAGCCGCACGCCGTGGCGGGAGCTGCAGCTTC ACGACTGGATGTCGGAGGAGTACGCGGACTTGAGAGATCCTTTCCTGAAGCTCTCTGGCT TCCCCTGCTCTTGGACTTTCTTCCACCATCTCCGGGAACAGATCCGCAGAGAGTTCACCC TGCACGACCACCTTCGGGAAGAGGCGCAGAGTGTGCTGGGTCAGCTCCGCCTGGGCCGCA CAGGGGACCGCCCGCGCACCTTTGTCGGCGTCCACGTGCGCCGTGGGGACTATCTGCAGG TTATGCCTCAGCGCTGGAAGGGTGTGGTGGGCGACAGCGCCTACCTCCGGCAGGCCATGG ACTGGTTCCGGGCACGGCACGAAGCCCCCGTTTTCGTGGTCACCAGCAACGGCATGGAGT GGTGTAAAGAAAACATCGACACCTCCCAGGGCGATGTGACGTTTGCTGGCGATGGACAGG AGGCTACACCGTGGAAAGACTTTGCCCTGCTCACACAGTGCAACCACACCATTATGACCA TTGGCACCTTCGGCTTCTGGGCTGCCTACCTGGCTGGCGGAGACACTGTCTACCTGGCCA ACTTCACCCTGCCAGACTCTGAGTTCCTGAAGATCTTTAAGCCGGAGGCGGCCTTCCTGC CCGAGTGGGTGGGCATTAATGCAGACTTGTCTCCACTCTGGACATTGGCTAAGCCTTGAG AGCCAGGGAGACTTTCTGA |
Restriction Sites | Please inquire |
ACCN | NM_000148 |
Insert Size | 1200 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_000148.2. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_000148.2, NP_000139.1 |
RefSeq Size | 4244 bp |
RefSeq ORF | 1098 bp |
Locus ID | 2523 |
UniProt ID | P19526 |
Cytogenetics | 19q13.33 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Glycosphingolipid biosynthesis - globo series, Glycosphingolipid biosynthesis - lacto and neolacto series, Metabolic pathways |
Summary | This gene encodes a Golgi stack membrane protein that is involved in the creation of a precursor of the H antigen, which is required for the final step in the synthesis of soluble A and B antigens. This is one of two genes encoding the galactoside 2-L-fucosyltransferase enzyme. Mutations in this gene are a cause of the H-Bombay blood group. [provided by RefSeq, Aug 2016] Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC210361 | FUT1 (Myc-DDK-tagged)-Human fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, H blood group) (FUT1) | 10 ug |
$457.00
|
|
RC210361L1 | Lenti ORF clone of Human fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, H blood group) (FUT1), Myc-DDK-tagged | 10 ug |
$757.00
|
|
RC210361L2 | Lenti ORF clone of Human fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, H blood group) (FUT1), mGFP tagged | 10 ug |
$757.00
|
|
RC210361L3 | Lenti ORF clone of Human fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, H blood group) (FUT1), Myc-DDK-tagged | 10 ug |
$757.00
|
|
RC210361L4 | Lenti ORF clone of Human fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, H blood group) (FUT1), mGFP tagged | 10 ug |
$757.00
|
|
RG210361 | FUT1 (tGFP-tagged) - Human fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, H blood group) (FUT1) | 10 ug |
$489.00
MSRP
$657.00
MSRP
$657.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.