Galactoside 2 alpha L fucosyltransferase 1 (FUT1) (NM_000148) Human Untagged Clone

CAT#: SC300016

FUT1 (untagged)-Human fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, H blood group) (FUT1)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: Galactoside 2 alpha L fucosyltransferase 1
• Synonyms: H; HH; HSC
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_000148 edited
  AAAAGCGGACTGTGGATCTGCCACCTGCAAGCAGCTCGGCCATGTGGCTCCGGAGCCATC
  GTCAGCTCTGCCTGGCCTTCCTGCTAGTCTGTGTCCTCTCTGTAATCTTCTTCCTCCATA
  TCCATCAAGACAGCTTTCCACATGGCCTAGGCCTGTCGATCCTGTGTCCAGACCGCCGCC
  TGGTGACACCCCCAGTGGCCATCTTCTGCCTGCCGGGTACTGCGATGGGCCCCAACGCCT
  CCTCTTCCTGTCCCCAGCACCCTGCTTCCCTCTCCGGCACCTGGACTGTCTACCCCAATG
  GCCGGTTTGGTAATCAGATGGGACAGTATGCCACGCTGCTGGCTCTGGCCCAGCTCAACG
  GCCGCCGGGCCTTTATCCTGCCTGCCATGCATGCCGCCCTGGCCCCGGTATTCCGCATCA
  CCCTGCCCGTGCTGGCCCCAGAAGTGGACAGCCGCACGCCGTGGCGGGAGCTGCAGCTTC
  ACGACTGGATGTCGGAGGAGTACGCGGACTTGAGAGATCCTTTCCTGAAGCTCTCTGGCT
  TCCCCTGCTCTTGGACTTTCTTCCACCATCTCCGGGAACAGATCCGCAGAGAGTTCACCC
  TGCACGACCACCTTCGGGAAGAGGCGCAGAGTGTGCTGGGTCAGCTCCGCCTGGGCCGCA
  CAGGGGACCGCCCGCGCACCTTTGTCGGCGTCCACGTGCGCCGTGGGGACTATCTGCAGG
  TTATGCCTCAGCGCTGGAAGGGTGTGGTGGGCGACAGCGCCTACCTCCGGCAGGCCATGG
  ACTGGTTCCGGGCACGGCACGAAGCCCCCGTTTTCGTGGTCACCAGCAACGGCATGGAGT
  GGTGTAAAGAAAACATCGACACCTCCCAGGGCGATGTGACGTTTGCTGGCGATGGACAGG
  AGGCTACACCGTGGAAAGACTTTGCCCTGCTCACACAGTGCAACCACACCATTATGACCA
  TTGGCACCTTCGGCTTCTGGGCTGCCTACCTGGCTGGCGGAGACACTGTCTACCTGGCCA
  ACTTCACCCTGCCAGACTCTGAGTTCCTGAAGATCTTTAAGCCGGAGGCGGCCTTCCTGC
  CCGAGTGGGTGGGCATTAATGCAGACTTGTCTCCACTCTGGACATTGGCTAAGCCTTGAG
  AGCCAGGGAGACTTTCTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_000148
• Insert Size: 1200 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The ORF of this clone has been fully sequenced and found to be a perfect match to NM_000148.2.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_000148.2, NP_000139.1
• RefSeq Size: 4244 bp
• RefSeq ORF: 1098 bp
• Locus ID: 2523
• UniProt ID: P19526
• Cytogenetics: 19q13.33
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: Glycosphingolipid biosynthesis - globo series, Glycosphingolipid biosynthesis - lacto and neolacto series, Metabolic pathways
• Gene Summary: This gene encodes a Golgi stack membrane protein that is involved in the creation of a precursor of the H antigen, which is required for the final step in the synthesis of soluble A and B antigens. This is one of two genes encoding the galactoside 2-L-fucosyltransferase enzyme. Mutations in this gene are a cause of the H-Bombay blood group. [provided by RefSeq, Aug 2016]
  Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.