Galactoside 2 alpha L fucosyltransferase 1 (FUT1) (NM_000148) Human Untagged Clone

SKU
SC300016
FUT1 (untagged)-Human fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, H blood group) (FUT1)
$457.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Galactoside 2 alpha L fucosyltransferase 1
Synonyms H; HH; HSC
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_000148 edited
AAAAGCGGACTGTGGATCTGCCACCTGCAAGCAGCTCGGCCATGTGGCTCCGGAGCCATC
GTCAGCTCTGCCTGGCCTTCCTGCTAGTCTGTGTCCTCTCTGTAATCTTCTTCCTCCATA
TCCATCAAGACAGCTTTCCACATGGCCTAGGCCTGTCGATCCTGTGTCCAGACCGCCGCC
TGGTGACACCCCCAGTGGCCATCTTCTGCCTGCCGGGTACTGCGATGGGCCCCAACGCCT
CCTCTTCCTGTCCCCAGCACCCTGCTTCCCTCTCCGGCACCTGGACTGTCTACCCCAATG
GCCGGTTTGGTAATCAGATGGGACAGTATGCCACGCTGCTGGCTCTGGCCCAGCTCAACG
GCCGCCGGGCCTTTATCCTGCCTGCCATGCATGCCGCCCTGGCCCCGGTATTCCGCATCA
CCCTGCCCGTGCTGGCCCCAGAAGTGGACAGCCGCACGCCGTGGCGGGAGCTGCAGCTTC
ACGACTGGATGTCGGAGGAGTACGCGGACTTGAGAGATCCTTTCCTGAAGCTCTCTGGCT
TCCCCTGCTCTTGGACTTTCTTCCACCATCTCCGGGAACAGATCCGCAGAGAGTTCACCC
TGCACGACCACCTTCGGGAAGAGGCGCAGAGTGTGCTGGGTCAGCTCCGCCTGGGCCGCA
CAGGGGACCGCCCGCGCACCTTTGTCGGCGTCCACGTGCGCCGTGGGGACTATCTGCAGG
TTATGCCTCAGCGCTGGAAGGGTGTGGTGGGCGACAGCGCCTACCTCCGGCAGGCCATGG
ACTGGTTCCGGGCACGGCACGAAGCCCCCGTTTTCGTGGTCACCAGCAACGGCATGGAGT
GGTGTAAAGAAAACATCGACACCTCCCAGGGCGATGTGACGTTTGCTGGCGATGGACAGG
AGGCTACACCGTGGAAAGACTTTGCCCTGCTCACACAGTGCAACCACACCATTATGACCA
TTGGCACCTTCGGCTTCTGGGCTGCCTACCTGGCTGGCGGAGACACTGTCTACCTGGCCA
ACTTCACCCTGCCAGACTCTGAGTTCCTGAAGATCTTTAAGCCGGAGGCGGCCTTCCTGC
CCGAGTGGGTGGGCATTAATGCAGACTTGTCTCCACTCTGGACATTGGCTAAGCCTTGAG
AGCCAGGGAGACTTTCTGA
Restriction Sites Please inquire
ACCN NM_000148
Insert Size 1200 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_000148.2.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_000148.2, NP_000139.1
RefSeq Size 4244 bp
RefSeq ORF 1098 bp
Locus ID 2523
UniProt ID P19526
Cytogenetics 19q13.33
Protein Families Druggable Genome, Transmembrane
Protein Pathways Glycosphingolipid biosynthesis - globo series, Glycosphingolipid biosynthesis - lacto and neolacto series, Metabolic pathways
Summary This gene encodes a Golgi stack membrane protein that is involved in the creation of a precursor of the H antigen, which is required for the final step in the synthesis of soluble A and B antigens. This is one of two genes encoding the galactoside 2-L-fucosyltransferase enzyme. Mutations in this gene are a cause of the H-Bombay blood group. [provided by RefSeq, Aug 2016]
Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:Galactoside 2 alpha L fucosyltransferase 1 (FUT1) (NM_000148) Human Untagged Clone
Your Rating
SKU Description Size Price
RC210361 FUT1 (Myc-DDK-tagged)-Human fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, H blood group) (FUT1) 10 ug
$457.00
RC210361L1 Lenti ORF clone of Human fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, H blood group) (FUT1), Myc-DDK-tagged 10 ug
$757.00
RC210361L2 Lenti ORF clone of Human fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, H blood group) (FUT1), mGFP tagged 10 ug
$757.00
RC210361L3 Lenti ORF clone of Human fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, H blood group) (FUT1), Myc-DDK-tagged 10 ug
$757.00
RC210361L4 Lenti ORF clone of Human fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, H blood group) (FUT1), mGFP tagged 10 ug
$757.00
RG210361 FUT1 (tGFP-tagged) - Human fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, H blood group) (FUT1) 10 ug
$489.00 MSRP $657.00 MSRP $657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.