Vasopressin V1b receptor (AVPR1B) (NM_000707) Human Untagged Clone

SKU
SC128112
AVPR1B (untagged)-Human arginine vasopressin receptor 1B (AVPR1B)
$457.00
2 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Vasopressin V1b receptor
Synonyms AVPR3; V1bR
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_000707 edited
ATGGATTCTGGGCCTCTGTGGGATGCCAACCCCACCCCTCGGGGCACCCTCTCTGCCCCC
AATGCCACAACACCCTGGCTGGGCCGGGATGAGGAGCTGGCCAAGGTGGAGATCGGAGTC
CTGGCCACTGTCCTGGTGCTGGCGACCGGGGGCAACCTGGCTGTGCTGCTGACCCTGGGC
CAGCTGGGCCGCAAGCGCTCCCGCATGCACCTGTTCGTGCTGCACTTAGCCCTGACAGAC
CTGGCCGTGGCGCTCTTCCAGGTGCTGCCACAGCTGCTGTGGGACATCACCTACCGCTTC
CAGGGCCCCGACCTCCTGTGCAGGGCCGTCAAGTACCTGCAGGTGCTCAGCATGTTTGCC
TCCACCTACATGCTGCTGGCCATGACGCTGGACCGCTACCTGGCTGTCTGTCACCCCCTG
CGCAGCCTCCAGCAGCCAGGCCAGTCCACCTACCTGCTCATCGCTGCTCCCTGGCTGCTG
GCCGCCATCTTCAGCCTCCCTCAAGTCTTCATTTTTTCCCTGCGGGAGGTGATCCAGGGC
TCAGGGGTGCTGGACTGCTGGGCAGACTTCGGCTTCCCTTGGGGGCCACGGGCCTACCTC
ACCTGGACCACCCTGGCTATCTTCGTTCTGCCGGTGACCATGCTCACGGCCTGCTACAGC
CTCATCTGCCATGAGATCTGTAAAAACCTAAAAGTCAAGACACAGGCCTGGCGGGTGGGA
GGAGGGGGCTGGAGGACTTGGGACAGGCCCTCACCTTCCACCTTAGCTGCCACCACTCGG
GGG:CTGCCATCTCGGGTCAGCAGCATCAACACCATCTCACGGG:CCAAGATCCGAACAG
TGAAGATGACCTTT:GTCATCGTGCTGGCCTACATCGCTTGCTGGGCTCCCTTCTTCAGT
GTCCAGATGTGGTCCGTGTGGGACAAGAATGCCCCTGATGAAGATTCCACCAATGTGGCT
TTCACCATCTCTATGCTTTTGGGCAACCTCAACAGCTGCTGCAA:CCCCTGGATCTACAT
:GGGCTTCAACAGCCACCTGTTACCGCGGCCCCTGCGTCACCTTGCCTGCTGTGGGGGTC
CCCAGCCCAGGATGCGCCGGCGGCTCT:CCGACGGCAGCCTCTCGAGCCGCCACACCACG
CTGCTGACCCGCTCCAGCTGCCCGGCCACCCTCAGCCTCAGCCTCAGCCTAACCCTCAGT
GGGAGGCCCAGGCCTGAAGAGTCACCAAGGGACTTGGAGCTGGCAGATGGGGAAGGCACC
GCTGAGACCATCATCTTTTAGGAAAGACTCGCTGGGGTCTGG
Restriction Sites Please inquire
ACCN NM_000707
Insert Size 1300 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_000707.2, NP_000698.1
RefSeq Size 2273 bp
RefSeq ORF 1275 bp
Locus ID 553
UniProt ID P47901
Cytogenetics 1q32.1
Protein Families Druggable Genome, GPCR, Transmembrane
Protein Pathways Calcium signaling pathway, Neuroactive ligand-receptor interaction, Vascular smooth muscle contraction
Summary The protein encoded by this gene acts as receptor for arginine vasopressin. This receptor belongs to the subfamily of G-protein coupled receptors which includes AVPR1A, V2R and OXT receptors. Its activity is mediated by G proteins which stimulate a phosphatidylinositol-calcium second messenger system. The receptor is primarily located in the anterior pituitary, where it stimulates ACTH release. It is expressed at high levels in ACTH-secreting pituitary adenomas as well as in bronchial carcinoids responsible for the ectopic ACTH syndrome. A spliced antisense transcript of this gene has been reported but its function is not known. [provided by RefSeq, Jul 2008]
Write Your Own Review
You're reviewing:Vasopressin V1b receptor (AVPR1B) (NM_000707) Human Untagged Clone
Your Rating
SKU Description Size Price
RC215919 AVPR1B (Myc-DDK-tagged)-Human arginine vasopressin receptor 1B (AVPR1B) 10 ug
$457.00
RC215919L1 Lenti ORF clone of Human arginine vasopressin receptor 1B (AVPR1B), Myc-DDK-tagged 10 ug
$757.00
RC215919L2 Lenti ORF clone of Human arginine vasopressin receptor 1B (AVPR1B), mGFP tagged 10 ug
$757.00
RC215919L3 Lenti ORF clone of Human arginine vasopressin receptor 1B (AVPR1B), Myc-DDK-tagged 10 ug
$757.00
RC215919L4 Lenti ORF clone of Human arginine vasopressin receptor 1B (AVPR1B), mGFP tagged 10 ug
$757.00
RG215919 AVPR1B (tGFP-tagged) - Human arginine vasopressin receptor 1B (AVPR1B) 10 ug
$489.00 MSRP $657.00 MSRP $657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.