PPP2R5E (NM_006246) Human Untagged Clone
SKU
SC127995
PPP2R5E (untagged)-Human protein phosphatase 2, regulatory subunit B', epsilon isoform (PPP2R5E)
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | PPP2R5E |
Synonyms | B56E; B56epsilon |
Vector | pCMV6-XL6 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
Fully Sequenced ORF
>NCBI ORF sequence for NM_006246, the custom clone sequence may differ by one or more nucleotides
ATGTCCTCAGCACCAACTACTCCTCCATCAGTGGATAAAGTAGACGGATTTTCTCGGAAGTCCGTCAGAA AAGCCAGACAGAAGAGGTCGCAAAGTTCCTCACAGTTTAGGTCTCAAGGCAAGCCTATTGAGTTAACACC TCTGCCGCTGCTAAAAGACGTTCCATCCTCAGAGCAGCCTGAACTGTTCCTAAAGAAACTTCAGCAGTGC TGTGTCATTTTTGACTTCATGGACACGCTATCTGATCTTAAAATGAAAGAATACAAGCGCTCCACTCTTA ATGAACTGGTGGACTACATTACAATAAGCAGAGGCTGTTTGACAGAGCAGACTTACCCTGAAGTAGTTAG AATGGTATCTTGCAATATATTCAGAACTCTCCCTCCTAGTGACAGCAATGAATTTGATCCAGAAGAAGAT GAACCTACCCTTGAGGCATCGTGGCCACACTTACAGCTTGTATATGAATTTTTCATACGATTTTTGGAAA GCCAAGAATTCCAACCCAGCATTGCCAAAAAATATATAGATCAGAAATTTGTATTACAGCTTCTGGAGCT ATTTGACAGCGAAGACCCTCGGGAACGGGACTACTTAAAAACAGTCTTACACAGAATTTATGGCAAGTTT CTTGGTCTTAGAGCATTTATCCGAAAACAGATTAACAATATTTTTCTAAGGTTTGTTTATGAAACAGAAC ACTTCAATGGTGTAGCTGAACTGCTGGAAATATTAGGAAGTATTATCAATGGCTTTGCTTTACCTCTTAA GGCAGAACACAAACAGTTTCTGGTGAAAGTATTGATCCCTTTACACACTGTCAGGAGCTTATCACTCTTC CATGCACAGCTGGCATATTGTATAGTACAGTTTCTGGAGAAAGATCCTTCACTCACAGAACCAGTTATTA GGGGGTTAATGAAATTTTGGCCTAAAACATGTAGTCAAAAAGAGGTCATGTTCCTTGGGGAACTGGAAGA AATATTGGATGTGATTGAACCTTCACAATTTGTTAAAATCCAAGAACCTTTGTTTAAACAAATCGCCAAG TGTGTATCTAGCCCCCATTTTCAGGTGGCAGAAAGAGCACTCTATTATTGGAATAATGAATACATCATGA GTTTGATAGAAGAAAACTCTAACGTCATCCTTCCCATCATGTTTTCCAGCCTTTATAGGATTTCAAAAGA ACATTGGAATCCGGCTATTGTGGCGTTGGTGTACAATGTGTTGAAGGCATTTATGGAAATGAACAGCACC ATGTTTGACGAGCTGACAGCCACATACAAGTCAGATCGTCAGCGTGAGAAAAAGAAAGAAAAGGAGCGTG AAGAATTGTGGAAAAAATTGGAGGATCTGGAGTTAAAGAGAGGTCTTAGACGTGATGGAATAATTCCAAC TTAA |
Restriction Sites | Please inquire |
ACCN | NM_006246 |
Insert Size | 3400 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This clone may be unstable or toxic at high copy number in common E. coli strain. We recommend using a lower copy number E. coli strain, such as CopyCutter strain (http://www.epibio.com/item.asp?ID=435) for transformation and plasmid preparation. Please be aware that the DNA yield could be low. Additional aliquots of this clone can be ordered from OriGene. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_006246.2, NP_006237.1 |
RefSeq Size | 4123 bp |
RefSeq ORF | 1404 bp |
Locus ID | 5529 |
UniProt ID | Q16537 |
Cytogenetics | 14q23.2 |
Domains | B56 |
Protein Families | Druggable Genome, Phosphatase |
Protein Pathways | Oocyte meiosis, Wnt signaling pathway |
Summary | The protein encoded by this gene belongs to the phosphatase 2A regulatory subunit B family. Protein phosphatase 2A is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes an epsilon isoform of the regulatory subunit B56 subfamily. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Aug 2013] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a). Variants 1 and 2 both encode the same isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC206033 | PPP2R5E (Myc-DDK-tagged)-Human protein phosphatase 2, regulatory subunit B', epsilon isoform (PPP2R5E) | 10 ug |
$289.00
MSRP
$457.00
MSRP
$457.00
|
|
RC206033L1 | Lenti-ORF clone of PPP2R5E (Myc-DDK-tagged)-Human protein phosphatase 2, regulatory subunit B', epsilon isoform (PPP2R5E) | 10 ug |
$757.00
|
|
RC206033L2 | Lenti-ORF clone of PPP2R5E (mGFP-tagged)-Human protein phosphatase 2, regulatory subunit B', epsilon isoform (PPP2R5E) | 10 ug |
$757.00
|
|
RC206033L3 | Lenti-ORF clone of PPP2R5E (Myc-DDK-tagged)-Human protein phosphatase 2, regulatory subunit B', epsilon isoform (PPP2R5E) | 10 ug |
$757.00
|
|
RC206033L4 | Lenti-ORF clone of PPP2R5E (mGFP-tagged)-Human protein phosphatase 2, regulatory subunit B', epsilon isoform (PPP2R5E) | 10 ug |
$757.00
|
|
RG206033 | PPP2R5E (tGFP-tagged) - Human protein phosphatase 2, regulatory subunit B', epsilon isoform (PPP2R5E) | 10 ug |
$489.00
MSRP
$657.00
MSRP
$657.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.