DLK(DLK1) (NM_003836) Human Untagged Clone

CAT#: SC127962

DLK1 (untagged)-Human delta-like 1 homolog (Drosophila) (DLK1)

USD 505


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name DLK(DLK1) (NM_003836) Human Untagged Clone
Symbol DLK1
Synonyms Delta1; DLK; DLK-1; FA1; pG2; Pref-1; PREF1; ZOG
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_003836, the custom clone sequence may differ by one or more nucleotides


ATGACCGCGACCGAAGCCCTCCTGCGCGTCCTCTTGCTCCTGCTGGCTTTCGGCCACAGCACCTATGGGG
CTGAATGCTTCCCGGCCTGCAACCCCCAAAATGGATTCTGCGAGGATGACAATGTTTGCAGGTGCCAGCC
TGGCTGGCAGGGTCCCCTTTGTGACCAGTGCGTGACCTCTCCCGGCTGCCTTCACGGACTCTGTGGAGAA
CCCGGGCAGTGCATTTGCACCGACGGCTGGGACGGGGAGCTCTGTGATAGAGATGTTCGGGCCTGCTCCT
CGGCCCCCTGTGCCAACAACGGGACCTGCGTGAGCCTGGACGATGGCCTCTATGAATGCTCCTGTGCCCC
CGGGTACTCGGGAAAGGACTGCCAGAAAAAGGACGGGCCCTGTGTGATCAACGGCTCCCCCTGCCAGCAC
GGAGGCACCTGCGTGGATGATGAGGGCCGGGCCTCCCATGCCTCCTGCCTGTGCCCCCCTGGCTTCTCAG
GCAATTTCTGCGAGATCGTGGCCAACAGCTGCACCCCCAACCCATGCGAGAACGACGGCGTCTGCACTGA
CATTGGGGGCGACTTCCGCTGCCGGTGCCCAGCCGGCTTCATCGACAAGACCTGCAGCCGCCCGGTGACC
AACTGCGCCAGCAGCCCGTGCCAGAACGGGGGCACCTGCCTGCAGCACACCCAGGTGAGCTACGAGTGTC
TGTGCAAGCCCGAGTTCACAGGTCTCACCTGTGTCAAGAAGCGCGCGCTGAGCCCCCAGCAGGTCACCCG
TCTGCCCAGCGGCTATGGGCTGGCCTACCGCCTGACCCCTGGGGTGCACGAGCTGCCGGTGCAGCAGCCG
GAGCACCGCATCCTGAAGGTGTCCATGAAAGAGCTCAACAAGAAAACCCCTCTCCTCACCGAGGGCCAGG
CCATCTGCTTCACCATCCTGGGCGTGCTCACCAGCCTGGTGGTGCTGGGCACTGTGGGTATCGTCTTCCT
CAACAAGTGCGAGACCTGGGTGTCCAACCTGCGCTACAACCACATGCTGCGGAAGAAGAAGAACCTGCTG
CTTCAGTACAACAGCGGGGAGGACCTGGCCGTCAACATCATCTTCCCCGAGAAGATCGACATGACCACCT
TCAGCAAGGAGGCCGGCGACGAGGAGATCTAA


5' Read Nucleotide Sequence
>OriGene 5' read for NM_003836 unedited
NGGTTGCATTTGTATACGACTCACTATAGGCGGCCGCGAATTCGCACCAGGCGGTGGAGA
GCGCAGCGCGCAGCCCGGTGCAGCCCTGGCTTTCCCCTCGCTGCGCGCCCGCGCCCCCTT
TCGCGTCCGCAACCAGAAGCCCAGTGCGGCGCCAGGAGCCGGACCCGCGCCCGCACCGCT
CCCGGGACCGCGACCCCGGCCGCCCAGAGATGACCGCGACCGAAGCCCTCCTGCGCGTCC
TCTTGCTCCTGCTGGCTTTCGGCCACAGCACCTATGGGGCTGAATGCTTCCCGGCCTGCA
ACCCCCAAAATGGATTCTGCGAGGATGACAATGTTTGCAGGTGCCAGCCTGGCTGGCAGG
GTCCCCTTTGTGACCAGTGCGTGACCTCTCCCGGCTGCCTTCACGGACTCTGTGGAGAAC
CCGGGCAGTGCATTTGCACCGACGGCTGGGACGGGGAGCTCTGTGATAGAGATGTTCGGG
CCTGCTCCTCGGCCCCCTGTGCCAACAACGGGACCTGCGTGAGCCTGGACGATGGCCTCT
ATGAATGCTCCTGTGCCCCCGGGTACTCGGGAAAGGACTGCCAGAAAAAGGACGGGCCCT
GTGTGATCAACGGCTCCCCCTGCCAGCACGGAGGCACCTGCGTGGATGATGAGGGCCGGG
CCTCCCATGCCTCCTGCCTGTGCCCCCCTGGCTTCTCAGGCAATTTCTGCGAGATCGTGG
CCAACAGCTGCACCCCCAACCCATGCGAGAACGACNGGCGTCTGCACTGACATCGNGGGC
GACTTCCGCTGCCGGTGCCCAGCCGGCTTTCATCGACAGACCTGCAGNNCGNCCGGTGAC
CAACTGCGCCAGCAGCCCGTGCCAGAACGGGGGCACCTGGCTGCAGCACACCAGTGAGCT
ACGAGTGTCTGTGCAAGCCCGATTNACAGGTCTNACCTGTGTCANGAGCGCGCGCTGAGC
CCCAGCAG
3' Read Nucleotide Sequence
>OriGene 3' genomic read for NM_003836 unedited
NGGGCCTTTTCGATGGAATTCTTCATATTATTCTGTATCATGCATTAGNGNANAGAAGNG
GATTGTTTTTGCATTGCGTTTGTCACACAGCAGCACAAAGACAATATATGTAAGCGTAGC
GTTCACCAGATTTGACACAAGAGATAGCGAACACCACAAAGATTAGGACAGACCGCGTGT
AGTAAGCTCTGCGGAACTCCAAGAATCTAGAGGGGGCTGTGGGAACGCTGCTTAGATCTC
CTCGTCGCCGGCCTCCTTGCTGAAGGTGGTCATGTCGATCTTCTCGGGGAAGATGATGTT
GACGGCCAGGTCCTCCCCGCTGTTGTACTGAAGCAGCAGGTTCTTCTTCTTCCGCAGCAT
GTGGTTGTAGCGCAGGTTGGACACCCAGGTCTCGCACTTGTTGAGGAAGACGATACCCAC
AGTGCCCAGCACCACCAGGCTGGTGAGCACGCCCAGGATGGTGAAGCAGATGGCCTGGCC
CTCGGTGAGGAGAGGGGTTTTCTTGTTGAGCTCTTTCATGGACACCTTCAGGATGCGGTG
CTCCGGCTGCTGCACCGGCAGCTCGTGCACCCCAGGGGTCAGGCGGTAGGCCAGCCCATA
GCCGCTGGGCAGACGGGTGACCTGCTGGGGGCTCAGCGCGCGCTTCTTGACACAGGTGAG
ACCTGTGAACTCGGGCTTGCACAGACACTCGTAGCTCACCTGGGTGTGCTGCAGGCAGGT
GCCCCCGTTCTGGCACGGGCTGCTGGCGCAGTTGGTCACCGGGCGGCTGCAGGTCTTGTC
GATGAAGCCGGCTGGGCACCGGGCAGCGGAAGTCGCCCCCGATGTCAGTGCAGACGCCGT
CGTTCTCGCATGGGTTGGGGGTGCAGCTGGTTGGCCCGATCTCA
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_003836
ORF Size 1152 bp
Insert Size 1700
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_003836.4, NP_003827
RefSeq Size 1532
RefSeq ORF 1152
Locus ID 8788
Cytogenetics 14q32.2
Domains EGF_CA, EGF, EGF
Protein Families ES Cell Differentiation/IPS, Transmembrane, Druggable Genome
Gene Summary May have a role in neuroendocrine differentiation. [UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations