PAX6 (NM_000280) Human Untagged Clone

CAT#: SC127933

PAX6 (untagged)-Human paired box 6 (PAX6), transcript variant 1

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name PAX6 (NM_000280) Human Untagged Clone
Symbol PAX6
Synonyms AN; AN2; D11S812E; FVH1; MGDA; WAGR
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_000280, the custom clone sequence may differ by one or more nucleotides


ATGCAGAACAGTCACAGCGGAGTGAATCAGCTCGGTGGTGTCTTTGTCAACGGGCGGCCACTGCCGGACT
CCACCCGGCAGAAGATTGTAGAGCTAGCTCACAGCGGGGCCCGGCCGTGCGACATTTCCCGAATTCTGCA
GGTGTCCAACGGATGTGTGAGTAAAATTCTGGGCAGGTATTACGAGACTGGCTCCATCAGACCCAGGGCA
ATCGGTGGTAGTAAACCGAGAGTAGCGACTCCAGAAGTTGTAAGCAAAATAGCCCAGTATAAGCGGGAGT
GCCCGTCCATCTTTGCTTGGGAAATCCGAGACAGATTACTGTCCGAGGGGGTCTGTACCAACGATAACAT
ACCAAGCGTGTCATCAATAAACAGAGTTCTTCGCAACCTGGCTAGCGAAAAGCAACAGATGGGCGCAGAC
GGCATGTATGATAAACTAAGGATGTTGAACGGGCAGACCGGAAGCTGGGGCACCCGCCCTGGTTGGTATC
CGGGGACTTCGGTGCCAGGGCAACCTACGCAAGATGGCTGCCAGCAACAGGAAGGAGGGGGAGAGAATAC
CAACTCCATCAGTTCCAACGGAGAAGATTCAGATGAGGCTCAAATGCGACTTCAGCTGAAGCGGAAGCTG
CAAAGAAATAGAACATCCTTTACCCAAGAGCAAATTGAGGCCCTGGAGAAAGAGTTTGAGAGAACCCATT
ATCCAGATGTGTTTGCCCGAGAAAGACTAGCAGCCAAAATAGATCTACCTGAAGCAAGAATACAGGTATG
GTTTTCTAATCGAAGGGCCAAATGGAGAAGAGAAGAAAAACTGAGGAATCAGAGAAGACAGGCCAGCAAC
ACACCTAGTCATATTCCTATCAGCAGTAGTTTCAGCACCAGTGTCTACCAACCAATTCCACAACCCACCA
CACCGGTTTCCTCCTTCACATCTGGCTCCATGTTGGGCCGAACAGACACAGCCCTCACAAACACCTACAG
CGCTCTGCCGCCTATGCCCAGCTTCACCATGGCAAATAACCTGCCTATGCAACCCCCAGTCCCCAGCCAG
ACCTCCTCATACTCCTGCATGCTGCCCACCAGCCCTTCGGTGAATGGGCGGAGTTATGATACCTACACCC
CCCCACATATGCAGACACACATGAACAGTCAGCCAATGGGCACCTCGGGCACCACTTCAACAGGACTCAT
TTCCCCTGGTGTGTCAGTTCCAGTTCAAGTTCCCGGAAGTGAACCTGATATGTCTCAATACTGGCCAAGA
TTACAGTAA


5' Read Nucleotide Sequence
>OriGene 5' read for NM_000280 unedited
TTGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGGGAAAACTCTCACCA
GCAACTCCTTTAAAACACCGTCATTTCAAACCATTGTGGTCTTCAAGCAACAACAGCAGC
ACAAAAAACCCCAACCAAACAAAACTCTTGACAGAAGCTGTGACAACCAGAAAGGATGCC
TCATAAAGGGGGAAGACTTTAACTAGGGGCGCGCAGATGTGTGAGGCCTTTTATTGTGAG
AGTGGACAGACATCCGAGATTTCAGAGCCCCATATTCGAGCCCCGTGGAATCCCGCGGCC
CCCAGCCAGAGCCAGCATGCAGAACAGTCACAGCGGAGTGAATCAGCTCGGTGGTGTCTT
TGTCAACGGGCGGCCACTGCCGGACTCCACCCGGCAGAAGATTGTAGAGCTAGCTCACAG
CGGGGCCCGGCCGTGCGACATTTCCCGAATTCTGCAGGTGTCCAACGGATGTGTGAGTAA
AATTCTGGGCAGGTATTACGAGACTGGCTCCATCAGACCCAGGGCAATCGGTGGTAGTAA
ACCGAGAGTAGCGACTCCAGAAGTTGTAAGCAAAATAGCCCAGTATAAGCGGGAGTGCCC
GTCCATCTTTGCTTGGGAAATCCGAGACAGATTACTGTCCGAGGGGGTCTGTACCAACGA
TAACATACCAAGCGTGTCATCAATAAACAGAGTTCTTCGCAACCTGNCTAGCGANAAGCA
CAGATGGGCGCAGACGGCATGTATGATAAACTAAGGATGTTGAACGGGCAGACCGGAAGC
TGGGGCACCCGNCCTGGTTGGTATCCNGGGACTTTCGTGCAGGGCACCTACGCAGAATGC
TGNCAGCACAGAAGGAGGGGAGAGATACCACTNCTCANTNCAN
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_000280
ORF Size 1269 bp
Insert Size 1600
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_000280.2, NP_000271
RefSeq Size 2816
Locus ID 5080
Cytogenetics 11p13
Domains homeobox, PAX
Protein Families Adult stem cells, Embryonic stem cells, Transcription Factors, Druggable Genome
Protein Pathways Maturity onset diabetes of the young
Gene Summary This gene encodes a homeobox and paired domain-containing protein that binds DNA and functions as a regulator of transcription. Activity of this protein is key in the development of neural tissues, particularly the eye. This gene is regulated by multiple enhancers located up to hundreds of kilobases distant from this locus. Mutations in this gene or in the enhancer regions can cause ocular disorders such as aniridia and Peter's anomaly. Use of alternate promoters and alternative splicing result in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2015].
Transcript Variant: This variant (1) represents the longest transcript. Variants 1, 3, 6 and 7 encode the same isoform (a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations