LD78 beta (CCL3L1) (NM_021006) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | LD78 beta |
Synonyms | 464.2; D17S1718; G0S19-2; LD78; LD78-beta(1-70); LD78BETA; MIP1AP; SCYA3L; SCYA3L1 |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
Fully Sequenced ORF
>OriGene ORF within SC127623 sequence for NM_021006 edited (data generated by NextGen Sequencing)
ATGCAGGTCTCCACTGCTGCCCTTGCCGTCCTCCTCTGCACCATGGCTCTCTGCAACCAG GTCCTCTCTGCACCACTTGCTGCTGACACGCCGACCGCCTGCTGCTTCAGCTACACCTCC CGACAGATTCCACAGAATTTCATAGCTGACTACTTTGAGACGAGCAGCCAGTGCTCCAAG CCCAGTGTCATCTTCCTAACCAAGAGAGGCCGGCAGGTCTGTGCTGACCCCAGTGAGGAG TGGGTCCAGAAATACGTCAGTGACCTGGAGCTGAGTGCCTGA Clone variation with respect to NM_021006.4
5' Read Nucleotide Sequence
>OriGene 5' read for NM_021006 unedited
NNCCCGTCAGAATTTGTAAACGACTCACTATAGGCGGCCGCGNAATCCCGGGNTGCAGCA AAGATAGTCAGTCCCTTCTTGGCTCTGCTGACACTCGAGCCCACATTCCATCACCTGCTC CCAATCATGCAGGTCTCCACTGCTGCCCTTGCCGTCCTCCTCTGCACCATGGCTCTCTGC AACCAGGTCCTCTCTGCACCACTTGCTGCTGACACGCCGACCGCCTGCTGCTTCAGCTAC ACCTCCCGACAGATTCCACAGAATTTCATAGCTGACTACTTTGAGACGAGCAGCCAGTGC TCCAAGCCCAGTGTCATCTTCCTAACCAAGAGAGGCCGGCAGGTCTGTGCTGACCCCAGT GAGGAGTGGGTCCAGAAATACGTCAGTGACCTGGAGCTGAGTGCCTGAGGGGTCCAGAAG CTTCGAGGCCCAGCGACCTCAGTGGGCCCAGTGGGGAGGAGCAGGAGCCTGAGCCTTGGG AACATGCGTGTGACCTCTACAGCTACCTCTTCTATGGACTGGTTATTGCCAAACAGCCAC ACTGTGGGACTCTTCTTAACTTAAATTTTAATTTATTTATACTATTTAGTTTTTATAATT TATTTTTGATTTCACAGTGTGTTTGTGATTGTTTGCTCTGAGAGTTCCCCCTGTCCCCTC CACCTTCCCTCACAGTGTGTCTGGTGACGACCGAGTGGCTGTCATCGGCCTGTGTAGGCA GTCATGGCACCAAAGCCACCAGACTGACAAATGTGTATCAGATGCTTTTGTTCAGGGCTG TGATCGGCCTGGGGAAATATAAAGATGTTCTTTTAAACGGTAAAAAAAAAAAAAAAAAAA AAAGGGCGCCCGCGTCATAGCTGTTTCCTGAACGATCCCGGTGGCATCCCTGG |
Restriction Sites | Please inquire |
ACCN | NM_021006 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_021006.4, NP_066286.1 |
RefSeq Size | 804 bp |
RefSeq ORF | 282 bp |
Locus ID | 6349 |
UniProt ID | P16619 |
Cytogenetics | 17q21.1 |
Protein Families | Druggable Genome, Secreted Protein |
Protein Pathways | Chemokine signaling pathway, Cytokine-cytokine receptor interaction |
Summary | This gene is one of several cytokine genes that are clustered on the q-arm of chromosome 17. Cytokines are a family of secreted proteins that function in inflammatory and immunoregulatory processes. The protein encoded by this gene binds to several chemokine receptors, including chemokine binding protein 2 and chemokine (C-C motif) receptor 5 (CCR5). CCR5 is a co-receptor for HIV, and binding of this protein to CCR5 inhibits HIV entry. The copy number of this gene varies among individuals, where most individuals have one to six copies, and a minority of individuals have zero or more than six copies. There are conflicting reports about copy number variation of this gene and its correlation to disease susceptibility. This record represents one of two copies that are present on the ALT_REF_LOCI_2 alternate haplotype of the GRCh38 human reference genome assembly. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2014] Transcript Variant: This variant (1) represents the shorter transcript but encodes the supported protein. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC213256 | CCL3L1 (Myc-DDK-tagged)-Human chemokine (C-C motif) ligand 3-like 1 (CCL3L1) | 10 ug |
$225.00
|
|
RC213256L1 | Lenti ORF clone of Human chemokine (C-C motif) ligand 3-like 1 (CCL3L1), Myc-DDK-tagged | 10 ug |
$525.00
|
|
RC213256L2 | Lenti ORF clone of Human chemokine (C-C motif) ligand 3-like 1 (CCL3L1), mGFP tagged | 10 ug |
$525.00
|
|
RC213256L3 | Lenti ORF clone of Human chemokine (C-C motif) ligand 3-like 1 (CCL3L1), Myc-DDK-tagged | 10 ug |
$525.00
|
|
RC213256L4 | Lenti ORF clone of Human chemokine (C-C motif) ligand 3-like 1 (CCL3L1), mGFP tagged | 10 ug |
$525.00
|
|
RG213256 | CCL3L1 (tGFP-tagged) - Human chemokine (C-C motif) ligand 3-like 1 (CCL3L1) | 10 ug |
$425.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.