Cannabinoid Receptor I (CNR1) (NM_033181) Human Untagged Clone

SKU
SC127569
CNR1 (untagged)-Human cannabinoid receptor 1 (brain) (CNR1), transcript variant 2
$457.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Cannabinoid Receptor I
Synonyms CANN6; CB-R; CB1; CB1A; CB1K5; CB1R; CNR
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_033181 edited
ATGAAGTCGATCCTAGATGGCCTTGCAGATACCACCTTCCGCACCATCACCACTGACCTC
CTGGGAAGTCCCTTCCAAGAGAAGATGACTGCGGGAGACAACCCCCAGCTAGTCCCAGCA
GACCAGGTGAACATTACAGAATTTTACAACAAGTCTCTCTCGTCCTTCAAGGAGAATGAG
GAGAACATCCAGTGTGGGGAGAACTTCATGGACATAGAGTGTTTCATGGTCCTGAACCCC
AGCCAGCAGCTGGCCATTGCAGTCCTGTCCCTCACGCTGGGCACCTTCACGGTCCTGGAG
AACCTCCTGGTGCTGTGCGTCATCCTCCACTCCCGCAGCCTCCGCTGCAGGCCTTCCTAC
CACTTCATCGGCAGCCTGGCGGTGGCAGACCTCCTGGGGAGTGTCATTTTTGTCTACAGC
TTCATTGACTTCCACGTGTTCCACCGCAAAGATAGCCGCAACGTGTTTCTGTTCAAACTG
GGTGGGGTCACGGCCTCCTTCACTGCCTCCGTGGGCAGCCTGTTCCTCACAGCCATCGAC
AGGTACATATCCATTCACAGGCCCCTGGCCTATAAGAGGATTGTCACCAGGCCCAAGGCC
GTGGTGGCGTTTTGCCTGATGTGGACCATAGCCATTGTGATCGCCGTGCTGCCTCTCCTG
GGCTGGAACTGCGAGAAACTGCAATCTGTTTGCTCAGACATTTTCCCACACATTGATGAA
ACCTACCTGATGTTCTGGATCGGGGTCACCAGCGTACTGCTTCTGTTCATCGTGTATGCG
TACATGTATATTCTCTGGAAGGCTCACAGCCACGCCGTCCGCATGATTCAGCGTGGCACC
CAGAAGAGCATCATCATCCACACGTCTGAGGATGGGAAGGTACAGGTGACCCGGCCAGAC
CAAGCCCGCATGGACATTAGGTTAGCCAAGACCCTGGTCCTGATCCTGGTGGTGTTGATC
ATCTGCTGGGGCCCTCTGCTTGCAATCATGGTGTATGATGTCTTTGGGAAGATGAACAAG
CTCATTAAGACGGTGTTTGCATTCTGCAGTATGCTCTGCCTGCTGAACTCCACCGTGAAC
CCCATCATCTATGCTCTGAGGAGTAAGGACCTGCGACACGCTTTCCGGAGCATGTTTCCC
TCTTGTGAAGGCACTGCGCAGCCTCTGGATAACAGCATGGGGGACTCGGACTGCCTGCAC
AAACACGCAAACAATGCAGCCAGTGTTCACAGGGCCGCAGAAAGCTGCATCAAGAGCACG
GTCAAGATTGCCAAGGTAACCATGTCTGTGTCCACAGACACGTCTGCCGAGGCTCTGTGA
Restriction Sites NotI-NotI
ACCN NM_033181
Insert Size 5500 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_033181.2, NP_149421.1
RefSeq Size 5387 bp
RefSeq ORF 1236 bp
Locus ID 1268
UniProt ID P21554
Cytogenetics 6q15
Domains 7tm_1
Protein Families Druggable Genome, GPCR, Transmembrane
Protein Pathways Neuroactive ligand-receptor interaction
Summary This gene encodes one of two cannabinoid receptors. The cannabinoids, principally delta-9-tetrahydrocannabinol and synthetic analogs, are psychoactive ingredients of marijuana. The cannabinoid receptors are members of the guanine-nucleotide-binding protein (G-protein) coupled receptor family, which inhibit adenylate cyclase activity in a dose-dependent, stereoselective and pertussis toxin-sensitive manner. The two receptors have been found to be involved in the cannabinoid-induced CNS effects (including alterations in mood and cognition) experienced by users of marijuana. Multiple transcript variants encoding two different protein isoforms have been described for this gene. [provided by RefSeq, May 2009]
Transcript Variant: This variant (2) lacks an internal segment near the 5' end of the coding region, compared to variant 1. The resulting protein (isoform b) has a shorter and distinct N-terminus compared to isoform a. PubMed ID: 15620723 referred to this variant and its protein as CB1b.
Write Your Own Review
You're reviewing:Cannabinoid Receptor I (CNR1) (NM_033181) Human Untagged Clone
Your Rating
SKU Description Size Price
RC218922 CNR1 (Myc-DDK-tagged)-Human cannabinoid receptor 1 (brain) (CNR1), transcript variant 2 10 ug
$289.00 MSRP $457.00 MSRP $457.00
RC218922L1 Lenti ORF clone of Human cannabinoid receptor 1 (brain) (CNR1), transcript variant 2, Myc-DDK-tagged 10 ug
$757.00
RC218922L2 Lenti ORF clone of Human cannabinoid receptor 1 (brain) (CNR1), transcript variant 2, mGFP tagged 10 ug
$757.00
RC218922L3 Lenti ORF clone of Human cannabinoid receptor 1 (brain) (CNR1), transcript variant 2, Myc-DDK-tagged 10 ug
$757.00
RC218922L4 Lenti ORF clone of Human cannabinoid receptor 1 (brain) (CNR1), transcript variant 2, mGFP tagged 10 ug
$757.00
RG218922 CNR1 (tGFP-tagged) - Human cannabinoid receptor 1 (brain) (CNR1), transcript variant 2 10 ug
$489.00 MSRP $657.00 MSRP $657.00
SC327858 CNR1 (untagged)-Human cannabinoid receptor 1 (brain) (CNR1) transcript variant 2 10 ug
$503.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.