CUTA (NM_015921) Human Untagged Clone

SKU
SC127197
CUTA (untagged)-Human cutA divalent cation tolerance homolog (E. coli) (CUTA), transcript variant 2
$150.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol CUTA
Synonyms ACHAP; C6orf82
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC127197 sequence for NM_015921 edited (data generated by NextGen Sequencing)
ATGCCGGCGCTGCTGCCTGTGGCCTCCCGCCTTTTGTTGCTACCCCGAGTCTTGCTGACC
ATGGCCTCTGGAAGCCCTCCGACCCAGCCCTCGCCGGCCTCGGATTCCGGCTCTGGCTAC
GTTCCGGGCTCGGTCTCTGCAGCCTTTGTTACTTGCCCCAACGAGAAGGTCGCCAAGGAG
ATCGCCAGGGCCGTGGTGGAGAAGCGCCTAGCAGCCTGCGTCAACCTCATCCCTCAGATT
ACATCCATCTATGAGTGGAAAGGGAAGATCGAGGAAGACAGTGAGGTGCTGATGATGATT
AAAACCCAAAGTTCCTTGGTCCCAGCTTTGACAGATTTTGTTCGTTCTGTGCACCCTTAC
GAAGTGGCCGAGGTAATTGCATTGCCTGTGGAACAGGGGAACTTTCCGTACCTGCAGTGG
GTGCACCAGGTCACAGAGTCAGTTTCTGACTCTATCACAGTCCTGCCATGA

Clone variation with respect to NM_015921.2
425 g=>a
5' Read Nucleotide Sequence
>OriGene 5' read for NM_015921 unedited
GCACGAGGGGCCGCATGAGTGGGGGGCGGGCTCCCGCGGTCCTGCTCGGCGGAGTGGCCT
CTCTGCTCCTGTCTTTTGTTTGGATGCCGGCGCTGCTGCCTGTGGCCTCCCGCCTTTTGT
TGCTACCCCGAGTCTTGCTGACCATGGCCTCTGGAAGCCCTCCGACCCAGCCCTCGCCGG
CCTCGGATTCCGGCTCTGGCTACGTTCCGGGCTCGGTCTCTGCAGCCTTTGTTACTTGCC
CCAACGAGAAGGTCGCCAAGGAGATCGCCAGGGCCGTGGTGGAGAAGCGCCTAGCAGCCT
GCGTCAACCTCATCCCTCAGATTACATCCATCTATGAGTGGAAAGGGAAGATCGAGGAAG
ACAGTGAGGTGCTGATGATGATTAAAACCCAAAGTTCCTTGGTCCCAGCTTTGACAGATT
TTGTTCGTTCTGTGCACCCTTACGAAGTGGCCGAGGTAATTGCATTGCCTGTGGAACAGG
GGAACTTTCCGTACCTGCAGTGGGTGCACCAGGTCACAGAGTCAGTTTCTGACTCTATCA
CAGTCCTGCCATGATGAGCCCTGTTCCTGCTCATCATGAAGATCCCCGCGATACTTCAAC
GCCTTCTGACTTCCAGGTGATGACTGGGCCCCCAATAAATCCCGTCTTTGGG
Restriction Sites NotI-NotI
ACCN NM_015921
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_015921.2, NP_057005.1
RefSeq Size 1214 bp
RefSeq ORF 471 bp
Locus ID 51596
UniProt ID O60888
Cytogenetics 6p21.32
Domains CutA1
Protein Families Transmembrane
Summary May form part of a complex of membrane proteins attached to acetylcholinesterase (AChE).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) uses an alternate splice site in the 5' coding region, compared to variant 1, resulting in a shorter protein (isoform 2). Isoform 2 has also been called isoform c. Variants 2, 3 and 4 encode the same protein.
Write Your Own Review
You're reviewing:CUTA (NM_015921) Human Untagged Clone
Your Rating
SKU Description Size Price
RC219077 CUTA (Myc-DDK-tagged)-Human cutA divalent cation tolerance homolog (E. coli) (CUTA), transcript variant 2 10 ug
$150.00
RC219077L3 Lenti ORF clone of Human cutA divalent cation tolerance homolog (E. coli) (CUTA), transcript variant 2, Myc-DDK-tagged 10 ug
$450.00
RC219077L4 Lenti ORF clone of Human cutA divalent cation tolerance homolog (E. coli) (CUTA), transcript variant 2, mGFP tagged 10 ug
$450.00
RG219077 CUTA (tGFP-tagged) - Human cutA divalent cation tolerance homolog (E. coli) (CUTA), transcript variant 2 10 ug
$489.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.