RAB11A (NM_004663) Human Untagged Clone

SKU
SC127144
RAB11A (untagged)-Human RAB11A, member RAS oncogene family (RAB11A), transcript variant 1
$450.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol RAB11A
Synonyms YL8
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_004663, the custom clone sequence may differ by one or more nucleotides


ATGGGCACCCGCGACGACGAGTACGACTACCTCTTTAAAGTTGTCCTTATTGGAGATTCTGGTGTTGGAA
AGAGTAATCTCCTGTCTCGATTTACTCGAAATGAGTTTAATCTGGAAAGCAAGAGCACCATTGGAGTAGA
GTTTGCAACAAGAAGCATCCAGGTTGATGGAAAAACAATAAAGGCACAGATATGGGACACAGCAGGGCAA
GAGCGATATCGAGCTATAACATCAGCATATTATCGTGGAGCTGTAGGTGCCTTATTGGTTTATGACATTG
CTAAACATCTCACATATGAAAATGTAGAGCGATGGCTGAAAGAACTGAGAGATCATGCTGATAGTAACAT
TGTTATCATGCTTGTGGGCAATAAGAGTGATCTACGTCATCTCAGGGCAGTTCCTACAGATGAAGCAAGA
GCTTTTGCAGAAAAGAATGGTTTGTCATTCATTGAAACTTCGGCCCTAGACTCTACAAATGTAGAAGCTG
CTTTTCAGACAATTTTAACAGAGATTTACCGCATTGTTTCTCAGAAGCAAATGTCAGACAGACGCGAAAA
TGACATGTCTCCAAGCAACAATGTGGTTCCTATTCATGTTCCACCAACCACTGAAAACAAGCCAAAGGTG
CAGTGCTGTCAGAACATCTAA


5' Read Nucleotide Sequence
>OriGene 5' read for NM_004663 unedited
NCGGTCAAAATTTGTATACGACTCCTATAGGCGGCCGCGNAATTCGCACCAGCACAGATA
CCACTGCTGCTCCCGCCCTTTCGCTCCTCGGCCGCGCAATGGGCACCCGCGACGACNAGT
ACGACTACCTCTTTAAAGTTGTCCTTATTGGAGATTCTGGTGTTGGAAAGAGTAATCTCC
TGTCTCGATTTACTCGAAATGAGTTTAATCTGGAAAGCAAGAGCACCATTGGAGTAGAGT
TTGCAACAAGAAGCATCCAGGTTGATGGAAAAACAATAAAGGCACAGATATGGGACACAG
CANGGCAAGAGCGATATCGAGCTATAACATCAGCATATTATCGTGGAGCTGTAGGTGCCT
TATTGGTTTATGACATTGCTAAACATCTCACATATGAAAATGTAGAGCGATGGCTGAAAG
AACTGAGAGATCATGCTGATAGTAACATTGTTATCATGCTTGTGGGCAATAAGAGTGATC
TACGTCATCTCAGGGCAGTTCCTACAGATGAAGCAAGAGCTTTTGCAGAAAAGAATGGTT
TGTCATTCATTGAAACTTCGGCCCTAGACTCTACAAATGTAGAAGCTGCTTTTCAGACAA
TTTTAACAGAGATTTACCGCATTGTTTCTCAGAAGCAAATGTCAGACAGACGCGAAAATG
ACATGTCTCCAAGCAACAATGTGGTTCCTATTCATGTTCCACCAACCACTGAAAACAGCC
AAAGGTGCAGTGCTGTCAGACATCTAAGCATTTCTCTTCTCCCTAGAGGCTGTGTATAGT
CCATTTCCCAGGTCTGAGATTTAATATATTTGTAATTCTGGGCACTTTTGTGTTTATTAC
TTCTACTTATGATTNTTNCCTGTCCTAGTCTTTGATTTAGCNTTATAATCATNCACTGTC
CGATGACTGCAGCTTTTTTTATGCTTGG
Restriction Sites NotI-NotI
ACCN NM_004663
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_004663.3, NP_004654.1
RefSeq Size 2393 bp
RefSeq ORF 651 bp
Locus ID 8766
UniProt ID P62491
Cytogenetics 15q22.31
Domains RAB, RAN, ras, RAS, RHO
Protein Families Druggable Genome
Protein Pathways Endocytosis
Summary The protein encoded by this gene belongs to the Rab family of the small GTPase superfamily. It is associated with both constitutive and regulated secretory pathways, and may be involved in protein transport. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:RAB11A (NM_004663) Human Untagged Clone
Your Rating
SKU Description Size Price
RC200352 RAB11A (Myc-DDK-tagged)-Human RAB11A, member RAS oncogene family (RAB11A), transcript variant 1 10 ug
$450.00
RC200352L1 Lenti ORF clone of Human RAB11A, member RAS oncogene family (RAB11A), transcript variant 1, Myc-DDK-tagged 10 ug
$750.00
RC200352L2 Lenti ORF clone of Human RAB11A, member RAS oncogene family (RAB11A), transcript variant 1, mGFP tagged 10 ug
$750.00
RC200352L3 Lenti ORF clone of Human RAB11A, member RAS oncogene family (RAB11A), transcript variant 1, Myc-DDK-tagged 10 ug
$750.00
RC200352L4 Lenti ORF clone of Human RAB11A, member RAS oncogene family (RAB11A), transcript variant 1, mGFP tagged 10 ug
$750.00
RG200352 RAB11A (tGFP-tagged) - Human RAB11A, member RAS oncogene family (RAB11A), transcript variant 1 10 ug
$489.00 MSRP $650.00 MSRP $650.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.