EP2 (PTGER2) (NM_000956) Human Untagged Clone

SKU SC126558

PTGER2 (untagged)-Human prostaglandin E receptor 2 (subtype EP2), 53kDa (PTGER2)

Product Data

• Type: Human Untagged Clone
• Target Symbol: EP2
• Synonyms: EP2
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_000956 edited; ATGGGCAATGCCTCCAATGACTCCCAGTCTGAGGACTGCGAGACGCGACAGTGGCTTCCC; CCAGGCGAAAGCCCAGCCATCAGCTCCGTCATGTTCTCGGCCGGGGTGCTGGGGAACCTC; ATAGCACTGGCGCTGCTGGCGCGCCGCTGGCGGGGGGACGTGGGGTGCAGCGCCGGCCGC; AGGAGCTCCCTCTCCTTGTTCCACGTGCTGGTGACCGAGCTGGTGTTCACCGACCTGCTC; GGGACCTGCCTCATCAGCCCAGTGGTACTGGCTTCGTACGCGCGGAACCAGACCCTGGTG; GCACTGGCGCCCGAGAGCCGCGCGTGCACCTACTTCGCTTTCGCCATGACCTTCTTCAGC; CTGGCCACGATGCTCATGCTCTTCGCCATGGCCCTGGAGCGCTACCTCTCGATCGGGCAC; CCCTACTTCTACCAGCGCCGCGTCTCGCGCTCCGGGGGCCTGGCCGTGCTGCCTGTCATC; TATGCAGTCTCCCTGCTCTTCTGCTCGCTGCCGCTGCTGGACTATGGGCAGTACGTCCAG; TACTGCCCCGGGACCTGGTGCTTCATCCGGCACGGGCGGACCGCTTACCTGCAGCTGTAC; GCCACCCTGCTGCTGCTTCTCATTGTCTCGGTGCTCGCCTGCAACTTCAGTGTCATTCTC; AACCTCATCCGCATGCACCGCCGAAGCCGGAGAAGCCGCTGCGGACCTTCCCTGGGCAGT; GGCCGGGGCGGCCCCGGGGCCCGCAGGAGAGGGGAAAGGGTGTCCATGGCGGAGGAGACG; GACCACCTCATTCTCCTGGCTATCATGACCATCACCTTCGCCGTCTGCTCCTTGCCTTTC; ACGATTTTTGCATATATGAATGAAACCTCTTCCCGAAAGGAAAAATGGGACCTCCAAGCT; CTTAGGTTTTTATCAATTAATTCAATAATTGACCCTTGGGTCTTTGCCATCCTTAGGCCT; CCTGTTCTGAGACTAATGCGTTCAGTCCTCTGTTGTCGGATTTCATTAAGAACACAAGAT; GCAACACAAACTTCCTGTTCTACACAGTCAGATGCCAGTAAACAGGCTGACCTTTGA;
• Restriction Sites: NotI-NotI
• ACCN: NM_000956
• Insert Size: 1100 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.; ; The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_000956.2, NP_000947.2
• RefSeq Size: 2395 bp
• RefSeq ORF: 1077 bp
• Locus ID: 5732
• UniProt ID: P43116
• Cytogenetics: 14q22.1
• Domains: 7tm_1
• Protein Families: Druggable Genome, GPCR, Transmembrane
• Protein Pathways: Neuroactive ligand-receptor interaction
• Summary: This gene encodes a receptor for prostaglandin E2, a metabolite of arachidonic acid which has different biologic activities in a wide range of tissues. Mutations in this gene are associated with aspirin-induced susceptibility to asthma. [provided by RefSeq, Oct 2009]