DYRK1B (NM_004714) Human Untagged Clone

CAT#: SC125606

DYRK1B (untagged)-Human dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1B (DYRK1B), transcript variant a


  "NM_004714" in other vectors (7)

Reconstitution Protocol

USD 586.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


Rabbit polyclonal anti-DYR1B antibody
    • 100 ul

USD 380.00

Other products for "DYRK1B"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DYRK1B
Synonyms AOMS3; MIRK
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_004714 edited
ATTACTGGGTAATCGGGGCCCTGGCTTGCCGCGTCCGCCGGATACCCTCAGCCAGTGGGC
AGGTCTGAGCTCGGGCTCCCCGAGCAGTTTGAGTCCCCTTGCCCGCTCCTTCAGGTCTCA
GCGGCGGTGGCAGCCGAGGTGCAGGATGCAAGAAGGCGCCCCCCGGCCGGGCTCCCGCTC
CAGGCCTCGCTCCCCTGCGGCCCTCTGAGCCCACCATGGCCGTCCCACCGGGCCATGGTC
CCTTCTCTGGCTTCCCAGGGCCCCAGGAGCACACGCAGGTATTGCCTGATGTGCGGCTAC
TGCCTCGGAGGCTGCCCCTGGCCTTCCGGGATGCAACCTCAGCCCCGCTGCGTAAGCTCT
CTGTGGACCTCATCAAGACCTACAAGCACATCAATGAGGTATACTATGCGAAGAAGAAGC
GGCGGGCCCAGCAGGCGCCACCCCAGGATTCGAGCAACAAGAAGGAGAAGAAGGTCCTGA
ACCATGGTTATGATGACGACAACCATGACTACATCGTGCGCAGTGGCGAGCGCTGGCTGG
AGCGCTACGAAATTGACTCGCTCATTGGCAAAGGCTCCTTTGGCCAGGTGGTGAAAGCCT
ATGATCATCAGACCCAGGAGCTTGTGGCCATCAAGATCATCAAGAACAAAAAGGCTTTCC
TGAACCAGGCCCAGATTGAGCTGCGGCTGCTGGAGCTGATGAACCAGCATGACACGGAGA
TGAAGTACTATATAGTACACCTGAAGCGGCACTTCATGTTCCGGAACCACCTGTGCCTGG
TATTTGAGCTGCTGTCCTACAACCTGTACGACCTCCTGCGCAACACCCACTTCCGCGGCG
TCTCGCTGAACCTGACCCGGAAGCTGGCGCAGCAGCTCTGCACGGCACTGCTCTTTCTGG
CCACGCCTGAGCTCAGCATCATTCACTGCGACCTCAAGCCCGAAAACATCTTGCTGTGCA
ACCCCAAGCGCAGCGCCATCAAGATTGTGGACTTCGGCAGCTCCTGCCAGCTTGGCCAGA
GGATCTACCAGTATATCCAGAGCCGCTTCTACCGCTCACCTGAGGTGCTCCTGGGCACAC
CCTACGACCTGGCCATTGACATGTGGTCCCTGGGCTGCATCCTTGTGGAGATGCACACCG
GAGAGCCCCTCTTCAGTGGCTCCAATGAGGTCGACCAGATGAACCGCATTGTGGAGGTGC
TGGGCATCCCACCGGCCGCCATGCTGGACCAGGCGCCCAAGGCTCGCAAGTACTTTGAAC
GGCTGCCTGGGGGTGGCTGGACCCTACGAAGGACGAAAGAACTCAGGAAGGATTACCAGG
GCCCCGGGACACGGCGGCTGCAGGAGGTGCTGGGCGTGCAGACGGGCGGGCCCGGGGGCC
GGCGGGCGGGGGAGCCGGGCCACAGCCCCGCCGACTACCTCCGCTTCCAGGACCTGGTGC
TGCGCATGCTGGAGTATGAGCCCGCCGCCCGCATCAGCCCCCTGGGGGCTCTGCAGCACG
GCTTCTTCCGCCGCACGGCCGACGAGGCCACCAACACGGGCCCGGCAGGCAGCAGTGCCT
CCACCTCGCCCGCGCCCCTCGACACCTGCCCCTCTTCCAGCACCGCCAGCTCCATCTCCA
GTTCTGGAGGCTCCAGTGGCTCCTCCAGTGACAACCGGACCTACCGCTACAGCAACCGAT
ATTGTGGGGGCCCTGGGCCCCCTATCACAGACTGTGAGATGAACAGCCCCCAGGTCCCAC
CCTCCCAGCCGCTGCGGCCCTGGGCAGGGGGTGATGTGCCCCACAAGACACATCAAGCCC
CTGCCTCTGCCTCGTCACTGCCTGGGACCGGGGCCCAGTTACCCCCCCAGCCCCGATACC
TTGGTCGTCCCCCATCACCAACCTCACCACCACCCCCGGAGCTGATGGATGTGAGCCTGG
TGGGCGGCCCTGCTGACTGCTCCCCACCTCACCCAGCGCCTGCCCCCCAGCACCCGGCTG
CCTCAGCCCTCCGGACTCGGATGACTGGAGGTCGTCCACCCCTCCCGCCTCCTGATGACC
CTGCCACTCTGGGGCCTCACCTGGGCCTCCGTGGTGTACCCCAGAGCACAGCAGCCAGCT
CGTGACCCTGCCCCCTCCCTGGGGCCCCTCCTGAAGCCATACCCTCCCCCATCTGGGGGC
CCTGGGCTCCCATCCTCATCTCTCTCCTTGACTGGAATTGCTGCTACCCAGCTGGGGTGG
GTGAGGCCTGCACTGATTGGGGCCTGGGGCAGGGGGGTCAAGGAGAGGGTTTTGGCCGCT
CCCTCCCCACTAAGGACTGGACCCTTGGGCCCCTCTCCCCCTTTTTTTCTATTTATTGTA
CCAAAGACAGTGGTGGTCCGGTGGAGGGAAGACCCCCCCTCACCCCAGGACCCTAGGAGG
GGGTGGGGGCAGGTAGGGGGAGATGGCCTTGCTCCTCCTCGCTGTACCCCCAGTAAAGAG
CTTTCTCACAAAAAAAAAAAAAAAAAA
>OriGene 5' read for NM_004714 unedited
GGCAAATTGCGGTTNGTAACCGATTTATATAGGCGGCCGCGCAATTCGCACGAGGCCAGG
GCGTGGGGGGGCCGGTTTGTTGTGGTCGCCATTTTGCTGGTTGCATTACTGGGTAATCGG
GGCCCTGGCTTGCCGCGTCCGCCGGATACCCTCAGCCAGTGGGCAGGTCTGAGCTCGGGC
TCCCCGAGCAGTTTGAGTCCCCTTGCCCGCTCCTTCAGGTCTCAGCGGCGGTGGCAGCCG
AGGTGCAGGATGCAAGAAGGCGCCCCCCGGCCGGGCTCCCGCTCCAGGCCTCGCTCCCCT
GCGGCCCTCTGAGCCCACCATGGCCGTCCCACCGGGCCATGGTCCCTTCTCTGGCTTCCC
AGGGCCCCAGGAGCACACGCAGGTATTGCCTGATGTGCGGCTACTGCCTCGGAGGCTGCC
CCTGGCCTTCCGGGATGCAACCTCAGCCCCGCTGCGTAAGCTCTCTGTGGACCTCATCAA
GACCTACAAGCACATCAATGAGGTATACTATGCGAAGAAGAAGCGGCGGGCCCAGCAGGC
GCCACCCCAGGATTCGAGCAACAAGAAGGAGAAGAAGGTCCTGAACCATGGTTATGATGA
CGACAACCATGACTACATCGTGCGCAGTGGCGAGCGCTGGCTGGAGCGCTACGAAATTGA
CTCGCTCATTGGCAAAGGCTCCTTTGGCCAGGTGGTGAAAGCCTATGATCATCAGACCCA
GGAGCTTGTGGCCATCAAGATCATCAAGAAACAAAAAGGCTTTCCTGAACCAGGCCCAGA
TTGAGCTGCGGCTGCTGGAGCTGATGAACCAGCATGACACGGAGATGAAGTACTATATAG
TACACCTGAAGCGGCACTTCATGTTCCGGAACCACCTGTGCCTGGTATTTGAGCTGCTGT
CCTACAACCTG
Restriction Sites Please inquire     
ACCN NM_004714
Insert Size 2500 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_004714.1, NP_004705.1
RefSeq Size 2540 bp
RefSeq ORF 1890 bp
Locus ID 9149
UniProt ID Q9Y463
Cytogenetics 19q13.2
Protein Families Druggable Genome, Protein Kinase, Transcription Factors
Gene Summary This gene encodes a member of a family of nuclear-localized protein kinases. The encoded protein participates in the regulation of the cell cycle. Expression of this gene may be altered in tumor cells, and mutations in this gene were found to cause abdominal obesity-metabolic syndrome 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
Transcript Variant: This variant (1, also known as 'a') represents the longest transcript and encodes the longest isoform (p69, also known as isoform a).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.