AMPK alpha 1 (PRKAA1) (NM_006251) Human Untagged Clone

SKU
SC125441
PRKAA1 (untagged)-Human protein kinase, AMP-activated, alpha 1 catalytic subunit (PRKAA1), transcript variant 1
$2,136.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol AMPK alpha 1
Synonyms AMPK; AMPKa1; AMPK alpha 1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC125441 sequence for NM_006251 edited (data generated by NextGen Sequencing)
ATGCGCAGACTCAGTTCCTGGAGAAAGATGGCGACAGCCGAGAAGCAGAAACACGACGGG
CGGGTGAAGATCGGCCACTACATTCTGGGTGACACGCTGGGGGTCGGCACCTTCGGCAAA
GTGAAGGTTGGCAAACATGAATTGACTGGGCATAAAGTAGCTGTGAAGATACTCAATCGA
CAGAAGATTCGGAGCCTTGATGTGGTAGGAAAAATCCGCAGAGAAATTCAGAACCTCAAG
CTTTTCAGGCATCCTCATATAATTAAACTGTACCAGGTCATCAGTACACCATCTGATATT
TTCATGGTGATGGAATATGTCTCAGGAGGAGAGCTATTTGATTATATCTGTAAGAATGGA
AGGCTGGATGAAAAAGAAAGTCGGCGTCTGTTCCAACAGATCCTTTCTGGTGTGGATTAT
TGTCACAGGCATATGGTGGTCCATAGAGATTTGAAACCTGAAAATGTCCTGCTTGATGCA
CACATGAATGCAAAGATAGCTGATTTTGGTCTTTCAAACATGATGTCAGATGGTGAATTT
TTAAGAACAAGTTGTGGCTCACCCAACTATGCTGCACCAGAAGTAATTTCAGGAAGATTG
TATGCAGGCCCAGAGGTAGATATATGGAGCAGTGGGGTTATTCTCTATGCTTTATTATGT
GGAACCCTTCCATTTGATGATGACCATGTGCCAACTCTTTTTAAGAAGATATGTGATGGG
ATCTTCTATACCCCTCAATATTTAAATCCTTCTGTGATTAGCCTTTTGAAACATATGCTG
CAGGTGGATCCCATGAAGAGGGCCACAATCAAAGATATCAGGGAACATGAATGGTTTAAA
CAGGACCTTCCAAAATATCTCTTTCCTGAGGATCCATCATATAGTTCAACCATGATTGAT
GATGAAGCCTTAAAAGAAGTATGTGAAAAGTTTGAGTGCTCAGAAGAGGAAGTTCTCAGC
TGTCTTTACAACAGAAATCACCAGGATCCTTTGGCAGTTGCCTACCATCTCATAATAGAT
AACAGGAGAATAATGAATGAAGCCAAAGATTTCTATTTGGCGACAAGCCCACCTGATTCT
TTTCTTGATGATCATCACCTGACTCGGCCCCATCCTGAAAGAGTACCATTCTTGGTTGCT
GAAACACCAAGGGCACGCCATACCCTTGATGAATTAAATCCACAGAAATCCAAACACCAA
GGTGTAAGGAAAGCAAAATGGCATTTAGGAATTAGAAGTCAAAGTCGACCAAATGATATT
ATGGCAGAAGTATGTAGAGCAATCAAACAATTGGATTATGAATGGAAGGTTGTAAACCCA
TATTATTTGCGTGTACGAAGGAAGAATCCTGTGACAAGCACTTACTCCAAAATGAGTCTA
CAGTTATACCAAGTGGATAGTAGAACTTATCTACTGGATTTCCGTAGTATTGATGATGAA
ATTACAGAAGCCAAATCAGGGACTGCTACTCCACAGAGATCGGGATCAGTTAGCAACTAT
CGATCTTGCCAAAGGAGTGATTCAGATGCTGAGGCTCAAGGAAAATCCTCAGAAGTTTCT
CTTACCTCATCTGTGACCTCACTTGACTCTTCTCCTGTTGACCTAACTCCAAGACCTGGA
AGTCACACAATAGAATTTTTTGAGATGTGTGCAAATCTAATTAAAATTCTTGCACAATAA

Clone variation with respect to NM_006251.5
Restriction Sites Please inquire
ACCN NM_006251
Insert Size 1700 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_006251.4, NP_006242.4
RefSeq Size 5093 bp
RefSeq ORF 5085 bp
Locus ID 5562
UniProt ID Q13131
Cytogenetics 5p13.1
Domains pkinase, S_TKc, TyrKc
Protein Families Druggable Genome, Protein Kinase
Protein Pathways Adipocytokine signaling pathway, Hypertrophic cardiomyopathy (HCM), Insulin signaling pathway, mTOR signaling pathway, Regulation of autophagy
Summary The protein encoded by this gene belongs to the ser/thr protein kinase family. It is the catalytic subunit of the 5'-prime-AMP-activated protein kinase (AMPK). AMPK is a cellular energy sensor conserved in all eukaryotic cells. The kinase activity of AMPK is activated by the stimuli that increase the cellular AMP/ATP ratio. AMPK regulates the activities of a number of key metabolic enzymes through phosphorylation. It protects cells from stresses that cause ATP depletion by switching off ATP-consuming biosynthetic pathways. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) lacks an in-frame coding exon compared to variant 2. The resulting isoform (1) lacks an internal segment, as compared to isoform 2.
Write Your Own Review
You're reviewing:AMPK alpha 1 (PRKAA1) (NM_006251) Human Untagged Clone
Your Rating
SKU Description Size Price
RC218572 PRKAA1 (Myc-DDK-tagged)-Human protein kinase, AMP-activated, alpha 1 catalytic subunit (PRKAA1), transcript variant 1 10 ug
$289.00 MSRP $780.00 MSRP $780.00
RC218572L1 Lenti ORF clone of Human protein kinase, AMP-activated, alpha 1 catalytic subunit (PRKAA1), transcript variant 1, Myc-DDK-tagged 10 ug
$1,080.00
RC218572L2 Lenti ORF clone of Human protein kinase, AMP-activated, alpha 1 catalytic subunit (PRKAA1), transcript variant 1, mGFP tagged 10 ug
$1,080.00
RC218572L3 Lenti ORF clone of Human protein kinase, AMP-activated, alpha 1 catalytic subunit (PRKAA1), transcript variant 1, Myc-DDK-tagged 10 ug
$1,080.00
RC218572L4 Lenti ORF clone of Human protein kinase, AMP-activated, alpha 1 catalytic subunit (PRKAA1), transcript variant 1, mGFP tagged 10 ug
$1,080.00
RG218572 PRKAA1 (tGFP-tagged) - Human protein kinase, AMP-activated, alpha 1 catalytic subunit (PRKAA1), transcript variant 1 10 ug
$489.00 MSRP $980.00 MSRP $980.00
SC323464 PRKAA1 (untagged)-Kinase deficient mutant (K47M) of Human protein kinase, AMP-activated, alpha 1 catalytic subunit (PRKAA1), transcript variant 1 10 ug
$2,136.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.