CD105 (ENG) (NM_000118) Human Untagged Clone

SKU
SC125309
ENG (untagged)-Human endoglin (ENG), transcript variant 2
$583.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol CD105
Synonyms END; HHT1; ORW1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_000118, the custom clone sequence may differ by one or more nucleotides


ATGGACCGCGGCACGCTCCCTCTGGCTGTTGCCCTGCTGCTGGCCAGCTGCAGCCTCAGCCCCACAAGTC
TTGCAGAAACAGTCCATTGTGACCTTCAGCCTGTGGGCCCCGAGAGGGGCGAGGTGACATATACCACTAG
CCAGGTCTCGAAGGGCTGCGTGGCTCAGGCCCCCAATGCCATCCTTGAAGTCCATGTCCTCTTCCTGGAG
TTCCCAACGGGCCCGTCACAGCTGGAGCTGACTCTCCAGGCATCCAAGCAAAATGGCACCTGGCCCCGAG
AGGTGCTTCTGGTCCTCAGTGTAAACAGCAGTGTCTTCCTGCATCTCCAGGCCCTGGGAATCCCACTGCA
CTTGGCCTACAATTCCAGCCTGGTCACCTTCCAAGAGCCCCCGGGGGTCAACACCACAGAGCTGCCATCC
TTCCCCAAGACCCAGATCCTTGAGTGGGCAGCTGAGAGGGGCCCCATCACCTCTGCTGCTGAGCTGAATG
ACCCCCAGAGCATCCTCCTCCGACTGGGCCAAGCCCAGGGGTCACTGTCCTTCTGCATGCTGGAAGCCAG
CCAGGACATGGGCCGCACGCTCGAGTGGCGGCCGCGTACTCCAGCCTTGGTCCGGGGCTGCCACTTGGAA
GGCGTGGCCGGCCACAAGGAGGCGCACATCCTGAGGGTCCTGCCGGGCCACTCGGCCGGGCCCCGGACGG
TGACGGTGAAGGTGGAACTGAGCTGCGCACCCGGGGATCTCGATGCCGTCCTCATCCTGCAGGGTCCCCC
CTACGTGTCCTGGCTCATCGACGCCAACCACAACATGCAGATCTGGACCACTGGAGAATACTCCTTCAAG
ATCTTTCCAGAGAAAAACATTCGTGGCTTCAAGCTCCCAGACACACCTCAAGGCCTCCTGGGGGAGGCCC
GGATGCTCAATGCCAGCATTGTGGCATCCTTCGTGGAGCTACCGCTGGCCAGCATTGTCTCACTTCATGC
CTCCAGCTGCGGTGGTAGGCTGCAGACCTCACCCGCACCGATCCAGACCACTCCTCCCAAGGACACTTGT
AGCCCGGAGCTGCTCATGTCCTTGATCCAGACAAAGTGTGCCGACGACGCCATGACCCTGGTACTAAAGA
AAGAGCTTGTTGCGCATTTGAAGTGCACCATCACGGGCCTGACCTTCTGGGACCCCAGCTGTGAGGCAGA
GGACAGGGGTGACAAGTTTGTCTTGCGCAGTGCTTACTCCAGCTGTGGCATGCAGGTGTCAGCAAGTATG
ATCAGCAATGAGGCGGTGGTCAATATCCTGTCGAGCTCATCACCACAGCGGAAAAAGGTGCACTGCCTCA
ACATGGACAGCCTCTCTTTCCAGCTGGGCCTCTACCTCAGCCCACACTTCCTCCAGGCCTCCAACACCAT
CGAGCCGGGGCAGCAGAGCTTTGTGCAGGTCAGAGTGTCCCCATCCGTCTCCGAGTTCCTGCTCCAGTTA
GACAGCTGCCACCTGGACTTGGGGCCTGAGGGAGGCACCGTGGAACTCATCCAGGGCCGGGCGGCCAAGG
GCAACTGTGTGAGCCTGCTGTCCCCAAGCCCCGAGGGTGACCCGCGCTTCAGCTTCCTCCTCCACTTCTA
CACAGTACCCATACCCAAAACCGGCACCCTCAGCTGCACGGTAGCCCTGCGTCCCAAGACCGGGTCTCAA
GACCAGGAAGTCCATAGGACTGTCTTCATGCGCTTGAACATCATCAGCCCTGACCTGTCTGGTTGCACAA
GCAAAGGCCTCGTCCTGCCCGCCGTGCTGGGCATCACCTTTGGTGCCTTCCTCATCGGGGCCCTGCTCAC
TGCTGCACTCTGGTACATCTACTCGCACACGCGTGAGTACCCCAGGCCCCCACAGTGA


Restriction Sites NotI-NotI
ACCN NM_000118
Insert Size 3000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_000118.1, NP_000109.1
RefSeq Size 3142 bp
RefSeq ORF 1878 bp
Locus ID 2022
UniProt ID P17813
Cytogenetics 9q34.11
Domains zona_pellucida
Protein Families Druggable Genome, ES Cell Differentiation/IPS, Transmembrane
Summary This gene encodes a homodimeric transmembrane protein which is a major glycoprotein of the vascular endothelium. This protein is a component of the transforming growth factor beta receptor complex and it binds to the beta1 and beta3 peptides with high affinity. Mutations in this gene cause hereditary hemorrhagic telangiectasia, also known as Osler-Rendu-Weber syndrome 1, an autosomal dominant multisystemic vascular dysplasia. This gene may also be involved in preeclampsia and several types of cancer. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2013]
Transcript Variant: This variant (2) has an additional segment in the 3' coding region which includes an earlier stop codon, compared to variant 1. The resulting isoform (2, also known as S-endoglin) has a shorter and distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The extent of this transcript is supported by transcript alignments.
Write Your Own Review
You're reviewing:CD105 (ENG) (NM_000118) Human Untagged Clone
Your Rating
SKU Description Size Price
RC221699 ENG (Myc-DDK-tagged)-Human endoglin (ENG), transcript variant 2 10 ug
$877.00
RC221699L1 Lenti ORF clone of Human endoglin (ENG), transcript variant 2, Myc-DDK-tagged 10 ug
$1,177.00
RC221699L2 Lenti ORF clone of Human endoglin (ENG), transcript variant 2, mGFP tagged 10 ug
$1,177.00
RC221699L3 Lenti ORF clone of Human endoglin (ENG), transcript variant 2, Myc-DDK-tagged 10 ug
$1,177.00
RC221699L4 Lenti ORF clone of Human endoglin (ENG), transcript variant 2, mGFP tagged 10 ug
$1,177.00
RG221699 ENG (tGFP-tagged) - Human endoglin (ENG), transcript variant 2 10 ug
$489.00 MSRP $1,077.00 MSRP $1,077.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.