Oct4(POU5F1) (NM_002701) Human Untagged Clone

CAT#: SC125252

POU5F1/OCT4 (untagged)-Human POU class 5 homeobox 1 (POU5F1/OCT4), transcript variant 1

USD 721.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Oct4(POU5F1) (NM_002701) Human Untagged Clone
Symbol POU5F1
Synonyms Oct-3; Oct-4; OCT3; OCT4; OTF-3; OTF3; OTF4
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_002701 edited
CTGCGGGGTGGCTGGATTTGGCCAGTATCGGGATGGGAATGCCTAGGATTCTGGATGGAT
CGGGGGAAGGCATAAGGGAGCAGCTGGCCATTGTGCTTATGGCTGTTGATGCATTGAGGG
ATAGCGCCACACACACATTCAATAAATTTGAGGAGCTGAGAGGGTGACTGGCCCCTGAAG
GCACAGTGCCAGAGGTCTGTGGAGAGGGGGTCAAGCACCTGGGTTCCTGAAGAACATGGA
GGTGTGGGAGTGATTCCAGACAGCTGGGATGTGCAGAGCCTGAGAGAGTGCCAGGGAGCG
GGTTGGGAGTTGAAAGTTGGGTGTGGTGGCTCACGCCTTTAATCATGACACTGGGCGGCA
GAGGCGGGAGGATTTCTTGAGGACAGGAATTCAAGACCAGCCTGGGTAACATAGCAAGGC
CCCATCTCTACTAAAAATAAAAAAACTAACAGGGCACAGTGGTCCAAGCCTGTAGTCCCA
GCCACTTAGGAGGCTGGAGCAGAAGGATTGCTTTGGCCCAGTAGATCGAGGCTACATTGA
GCCATCATTGTACTCCACTGCACTCCAGTCTGGGCAACAAAGTGAGACCCTGTCTTAAAA
AATAAAAATAAAAAAAGTTTCTGTGGGGGACCTGCACTGAGGTCCTGGAGGGGCGCCAGT
TGTGTCTCCCGGTTTTCCCCTTCCACAGACACCATTGCCACCACCATTAGGCAAACATCC
TTCGCCTCAGTTTCTCCCCCCACCTCCCTCTCCTCCACCCATCCAGGGGGCGGGGCCAGA
GGTCAAGGCTAGTGGGTGGGACTGGGGAGGGAGAGAGGGGTTGAGTAGTCCCTTCGCAAG
CCCTCATTTCACCAGGCCCCCGGCTTGGGGCGCCTTCCTTCCCCATGGCGGGACACCTGG
CTTCGGATTTCGCCTTCTCGCCCCCTCCAGGTGGTGGAGGTGATGGGCCAGGGGGGCCGG
AGCCGGGCTGGGTTGATCCTCGGACCTGGCTAAGCTTCCAAGGCCCTCCTGGAGGGCCAG
GAATCGGGCCGGGGGTTGGGCCAGGCTCTGAGGTGTGGGGGATTCCCCCATGCCCCCCGC
CGTATGAGTTCTGTGGGGGGATGGCGTACTGTGGGCCCCAGGTTGGAGTGGGGCTAGTGC
CCCAAGGCGGCTTGGAGACCTCTCAGCCTGAGGGCGAAGCAGGAGTCGGGGTGGAGAGCA
ACTCCGATGGGGCCTCCCCGGAGCCCTGCACCGTCACCCCTGGTGCCGTGAAGCTGGAGA
AGGAGAAGCTGGAGCAAAACCCGGAGGAGTCCCAGGACATCAAAGCTCTGCAGAAAGAAC
TCGAGCAATTTGCCAAGCTCCTGAAGCAGAAGAGGATCACCCTGGGATATACACAGGCCG
ATGTGGGGCTCACCCTGGGGGTTCTATTTGGGAAGGTATTCAGCCAAACGACCATCTGCC
GCTTTGAGGCTCTGCAGCTTAGCTTCAAGAACATGTGTAAGCTGCGGCCCTTGCTGCAGA
AGTGGGTGGAGGAAGCTGACAACAATGAAAATCTTCAGGAGATATGCAAAGCAGAAACCC
TCGTGCAGGCCCGAAAGAGAAAGCGAACCAGTATCGAGAACCGAGTGAGAGGCAACCTGG
AGAATTTGTTCCTGCAGTGCCCGAAACCGACACTGCAGCAGATCAGCCACATCGCCCAGC
AGCTTGGGCTCGAGAAGGATGTGGTCCGAGTGTGGTTCTGTAACCGGCGCCAGAAGGGCA
AGCGATCAAGCAGCGACTATGCACAACGAGAGGATTTTGAGGCTGCTGGGTCTCCTTTCT
CAGGGGGACCAGTGTCCTTTCCTCTGGCCCCAGGGCCCCATTTTGGTACCCCAGGCTATG
GGAGCCCTCACTTCACTGCACTGTACTCCTCGGTCCCTTTCCCTGAGGGGGAAGCCTTTC
CCCCTGTCTCCGTCACCACTCTGGGCTCTCCCATGCATTCAAACTGAGGTGCCTGCCCTT
CTAGGAATGGGGGACAGGGGGAGGGGAGGAGCTAGGGAAAGAAAACCTGGAGTTTGTGCC
AGGGTTTTTGGGATTAAGTTCTTCATTCACTAAGGAAGGAATTGGGAACACAAAGGGTGG
GGGCAGGGGAGTTTGGGGCAACTGGTTGGAGGGAAGGTGAAGTTCAATGATGCTCTTGAT
TTTAATCCCACATCATGTATCACTTTTTTCTTAAATAAAGAAGCCTGGGACACAGTAGAT
AGAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
5' Read Nucleotide Sequence
>OriGene 5' genomic read for NM_002701 unedited
ACTATAGGGCGGCCGCGAATTCGGCACGAGGCTGCGGGGTGGCTGGATTTGGCCAGTATC
GGGATGGGAATGCCTAGGATTCTGGATGGATCGGGGGAAGGCATAAGGGAGCAGCTGGCC
ATTGTGCTTATGGCTGTTGATGCATTGAGGGATAGCGCCACACACACATTCAATAAATTT
GAGGAGCTGAGAGGGTGACTGGCCCCTGAAGGCACAGTGCCAGAGGTCTGTGGAGAGGGG
GTCAAGCACCTGGGTTCCTGAAGAACATGGAGGTGTGGGAGTGATTCCAGACAGCTGGGA
TGTGCAGAGCCTGAGAGAGTGCCAGGGAGCGGGTTGGGAGTTGAAAGTTGGGTGTGGTGG
CTCACGCCTTTAATCATGACACTGGGCGGCAGAGGCGGGAGGATTTCTTGAGGACAGGAA
TTCAAGACCAGCCTGGGTAACATAGCAAGGCCCCATCTCTACTAAAAATAAAAAAACTAA
CAGGGCACAGTGGTCCAAGCCTGTAGTCCCAGCCACTTAGGAGGCTGGAGCAGAAGGATT
GCTTTGGCCCAGTAGATCGAGGCTACATTGAGCCATCATTGTACTCCACTGCACTCCAGT
CTGGGCAACAAAGTGAGACCCTGTCTTANAAAATAAAAATAAAAAAAGTTTCTGTGGNGG
ACCTGCACTGAGGTCCTGGAGGGGCGCCAGTTGTGTCTCCCGGTTTTCCCCTTCCACAGA
CACCATTGCCACCACCN
3' Read Nucleotide Sequence
>OriGene 3' read for NM_002701 unedited
CCAGGAGAGGCACTGGGGAGGGGTCACAGGGATGCCACCCGGGATCTGTTCAGGAAACAG
CTATGACCGCGGCCGCAATCTAGAGTCGAGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTC
TATCTACTGTGTCCCAGGCTTCTTTATTTAAGAAAAAAGTGATACATGATGTGGGATTAA
AATCAAGAGCATCATTGAACTTCACCTTCCCTCCAACCAGTTGCCCCAAACTCCCCTGCC
CCCACCCTTTGTGTTCCCAATTCCTTCCTTAGTGAATGAAGAACTTAATCCCAAAAACCC
TGGCACAAACTCCAGGTTTTCTTTCCCTAGCTCCTCCCCTCCCCCTGTCCCCCATTCCTA
GAAGGGCAGGCACCTCAGTTTGAATGCATGGGAGAGCCCAGAGTGGTGACGGAGACAGGG
GGAAAGGCTTCCCCCTCAGGGAAAGGGACCGAGGAGTACAGTGCAGTGAAGTGAGGGCTC
CCATAGCCTGGGGTACCAAAATGGGGCCCTGGGGCCAGAGGAAAGGACACTGGTCCCCCT
GAGAAAGGAGACCCAGCAGCCTCAAAATCCTCTCGTTGTGCATAGTCGCTGCTTGATCGC
TTGCCCTTCTGGCGCCGGTTACAGAACCACACTCGGACCACATCCTTCTCGAGCCCAAGC
TGCTGGGCGATGTGGCTGATCTGCTGCAGTGTCGGTTTCGGGCACTGCAGGAACAAAATC
TCCAGGTTGCCTCTCACTCGN
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_002701
ORF Size 1083 bp
Insert Size 2300
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_002701.3, NP_002692
RefSeq Size 1417
Locus ID 5460
Cytogenetics 6p21.33
Protein Families Stem cell - Pluripotency, Adult stem cells, Cancer stem cells, Embryonic stem cells, Induced pluripotent stem cells, Transcription Factors
Gene Summary This gene encodes a transcription factor containing a POU homeodomain that plays a key role in embryonic development and stem cell pluripotency. Aberrant expression of this gene in adult tissues is associated with tumorigenesis. This gene can participate in a translocation with the Ewing's sarcoma gene on chromosome 21, which also leads to tumor formation. Alternative splicing, as well as usage of alternative AUG and non-AUG translation initiation codons, results in multiple isoforms. One of the AUG start codons is polymorphic in human populations. Related pseudogenes have been identified on chromosomes 1, 3, 8, 10, and 12. [provided by RefSeq, Oct 2013]
Transcript Variant: This variant (1, also known as OCT4A) represents the shortest transcript and encodes the longest isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations