IL2 (NM_000586) Human Untagged Clone

USD 420.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name IL2 (NM_000586) Human Untagged Clone
Type Human Untagged Clone
Tag Tag Free
Symbol IL2
Synonyms IL-2; lymphokine; TCGF
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Cell Selection None
Sequence Data
>OriGene ORF within SC125234 sequence for NM_000586 edited (data generated by NextGen Sequencing)
ATGTACAGGATGCAACTCCTGTCTTGCATTGCACTAAGTCTTGCACTTGTCACAAACAGT
GCACCTACTTCAAGTTCTACAAAGAAAACACAGCTACAACTGGAGCATTTACTTCTGGAT
TTACAGATGATTTTGAATGGAATTAATAATTACAAGAATCCCAAACTCACCAGGATGCTC
ACATTTAAGTTTTACATGCCCAAGAAGGCCACAGAACTGAAACATCTTCAGTGTCTAGAA
GAAGAACTCAAACCTCTGGAGGAAGTGCTAAATTTAGCTCAAAGCAAAAACTTTCACTTA
AGACCCAGGGACTTAATCAGCAATATCAACGTAATAGTTCTGGAACTAAAGGGATCTGAA
ACAACATTCATGTGTGAATATGCTGATGAGACAGCAACCATTGTAGAATTTCTGAACAGA
TGGATTACCTTTTGTCAAAGCATCATCTCAACACTGACTTGA

Clone variation with respect to NM_000586.3
114 g=>t
>OriGene 5' read for NM_000586 unedited
GACTCACTATAGGGCGGCCGCGAATTCCCTGCCACAATGTACAGGATGCAACTCCTGTCT
TGCATTGCACTAAGTCTTGCACTTGTCACAAACAGTGCACCTACTTCAAGTTCTACAAAG
AAAACACAGCTACAACTGGAGCATTTACTTCTGGATTTACAGATGATTTTGAATGGAATT
AATAATTACAAGAATCCCAAACTCACCAGGATGCTCACATTTAAGTTTTACATGCCCAAG
AAGGCCACAGAACTGAAACATCTTCAGTGTCTAGAAGAAGAACTCAAACCTCTGGAGGAA
GTGCTAAATTTAGCTCAAAGCAAAAACTTTCACTTAAGACCCAGGGACTTAATCAGCAAT
ATCAACGTAATAGTTCTGGAACTAAAGGGATCTGAAACAACATTCATGTGTGAATATGCT
GATGAGACAGCAACCATTGTAGAATTTCTGAACAGATGGATTACCTTTTGTCAAAGCATC
ATCTCAACACTGACTTGATAATTAAGTGCTTCCCACTTAAAACATATCAGGCCTCGACTC
TAGATTGCGGCCGCGGTCATANGCTGTTCCTGAACAGATTCCGGGTGGGATCCTTGTGAC
CCTTCCCATGGCGCTTTCGGGCCCGGAGTAGTCCTACTCAGGGCACACAACTTGGCCATA
AAAATAAATGGCACAATTTGTCCGCGAGAGGGGCCTCTAAAATATAGGGGGGGGGGGGGG
GGGGGGGGGGGCGCTTGGAAACACCGGTGGGCCG
>OriGene 3' read for NM_000586 unedited
ACCCATGGATCCTGGGCTGATGGCACTTNCCAGGNCCAGNAAAGCACTGGGGNAGGGTCA
CAGGGCATGCCACCCGGGTTCTGTTCAGGAAACAGCTATGACCGCGGCCGCAATCTAGAG
TCGAGGCCTGATATGTTTTAAGTGGGAAGCACTTAATTATCAAGTCAGTGTTGAGATGAT
GCTTTGACAAAAGGTAATCCATCTGTTCAGAAATTCTACAATGGTTGCTGTCTCATCAGC
ATATTCACACATGAATGTTGTTTCAGATCCCTTTAGTTCCAGAACTATTACGTTGATATT
GCTGATTAAGTCCCTGGGTCTTAAGTGAAAGTTTTTGCTTTGAGCTAAATTTAGCACTTC
CTCCAGAGGTTTGAGTTCTTCTTCTAGACACTGAAGATGTTTCAGTTCTGTGGCCTTCTT
GGGCATGTAAAACTTAAATGTGAGCATCCTGGTGAGTTTGGGATTCTTGTAATTATTAAT
TCCATTCAAAATCATCTGTAAATCCAGAAGTAAATGCTCCAGTTGTAGCTGTGTTTTCTT
TGTAGAACTTGAAGTAGGTGCACTGTTTGTGACAAGTGCAAGACTTAGTGCAATGCAAGA
CAGGAGTTGCATCCTGTACATTGTGGCAGGGAATTCGCGGCCGCCCTATAGTGAGTCGTA
TTACANAATTCTGACGGTTCACTAAACGAGCTCTGCTTATATAGACCTCCCACCGTACAC
GCCTACCGCCCATTTGCGTCAACGGNGCGGGGTTATTACGACATTTTGGAAAGTCCNGTT
GATTTTGGGTGCAAAACANACTCCCATTGACGTCAATGGGGTGGAGACTTGGAAATCCCC
GTGAGTCAAACCGCTATCCACGCCCATTGGTGTACTGGGCAAACCGCATCACCATGGTAA
TAGCGATGACTATACGTAGATTACTGGCAT
Restriction Sites Please inquire     
ACCN NM_000586
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_000586.2, NP_000577.2
RefSeq Size 1047 bp
RefSeq ORF 462 bp
Locus ID 3558
Cytogenetics 4q27
Protein Families Druggable Genome, Secreted Protein
Protein Pathways Allograft rejection, Autoimmune thyroid disease, Cytokine-cytokine receptor interaction, Graft-versus-host disease, Jak-STAT signaling pathway, T cell receptor signaling pathway, Type I diabetes mellitus
Gene Summary The protein encoded by this gene is a secreted cytokine that is important for the proliferation of T and B lymphocytes. The receptor of this cytokine is a heterotrimeric protein complex whose gamma chain is also shared by interleukin 4 (IL4) and interleukin 7 (IL7). The expression of this gene in mature thymocytes is monoallelic, which represents an unusual regulatory mode for controlling the precise expression of a single gene. The targeted disruption of a similar gene in mice leads to ulcerative colitis-like disease, which suggests an essential role of this gene in the immune response to antigenic stimuli. [provided by RefSeq, Jul 2008]

Citations (3)

Other Versions

Frequently bought together (2)
IL2 mouse monoclonal antibody,clone OTI2C9
    • 100 ul

USD 379.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools