Uridine Phosphorylase 1 (UPP1) (NM_181597) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | Uridine Phosphorylase 1 |
Synonyms | UDRPASE; UP; UPASE; UPP |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
Fully Sequenced ORF
>NCBI ORF sequence for NM_181597, the custom clone sequence may differ by one or more nucleotides
ATGGCGGCCACGGGAGCCAATGCAGAGAAAGCTGAAAGTCACAATGATTGCCCCGTCAGACTTTTAAATC CAAACATAGCAAAAATGAAAGAAGATATTCTCTATCATTTCAATCTCACCACTAGCAGACACAATTTCCC AGCCTTGTTTGGAGATGTGAAGTTTGTGTGTGTTGGTGGAAGCCCCTCCCGGATGAAAGCCTTCATCAGG TGCGTTGGTGCAGAGCTGGGCCTTGACTGCCCAGGTAGAGACTATCCCAACATCTGTGCGGGAACTGACC GCTATGCCATGTATAAAGTAGGACCGGTGCTGTCTGTCAGTCATGGTATGGGCATTCCTTCTATCTCAAT CATGTTGCATGAGCTCATAAAGCTGCTGTACTATGCCCGGTGCTCCAACGTCACTATCATCCGCATTGGC ACTTCTGGTGGGATAGGTCTGGAGCCCGGCACTGTGGTCATAACAGAGCAGGCAGTGGATACCTGCTTCA AGGCAGAGTTTGAGCAGATTGTCCTGGGGAAGCGGGTCATCCGGAAAACGGACCTTAACAAGAAGCTGGT GCAGGAGCTGTTGCTGTGTTCTGCAGAGCTGAGCGAGTTCACCACAGTGGTGGGGAACACCATGTGCACC TTGGACTTCTATGAAGGGCAAGGCCGTCTGGATGGGGCTCTCTGCTCCTACACGGAGAAGGACAAGCAGG CGTATCTGGAGGCAGCCTATGCAGCCGGCGTCCGCAATATCGAGATGGAGTCCTCGGTGTTTGCCGCCAT GTGCAGCGCCTGCGGCCTCCAAGCGGCCGTGGTGTGTGTCACCCTCCTGAACCGCCTGGAAGGGGACCAG ATCAGCAGCCCTCGCAATGTGCTCAGCGAGTACCAGCAGAGGCCGCAGCGGCTGGTGAGCTACTTCATCA AGAAGAAACTGAGCAAGGCCTGA |
Restriction Sites | NotI-NotI |
ACCN | NM_181597 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_181597.1, NP_853628.1 |
RefSeq Size | 1857 bp |
RefSeq ORF | 933 bp |
Locus ID | 7378 |
Cytogenetics | 7p12.3 |
Protein Pathways | Drug metabolism - other enzymes, Metabolic pathways, Pyrimidine metabolism |
Summary | This gene encodes a uridine phosphorylase, an enzyme that catalyzes the reversible phosphorylation of uridine (or 2'- deoxyuridine) to uracil and ribose-1-phosphate (or deoxyribose-1-phosphate). The encoded enzyme functions in the degradation and salvage of pyrimidine ribonucleosides. [provided by RefSeq, Oct 2016] Transcript Variant: This variant (2) is the longer transcript. Both variants 1 and 2 encode the same isoform. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC219125 | UPP1 (Myc-DDK-tagged)-Human uridine phosphorylase 1 (UPP1), transcript variant 2 | 10 ug |
$300.00
|
|
RC219125L3 | Lenti ORF clone of Human uridine phosphorylase 1 (UPP1), transcript variant 2, Myc-DDK-tagged | 10 ug |
$600.00
|
|
RC219125L4 | Lenti ORF clone of Human uridine phosphorylase 1 (UPP1), transcript variant 2, mGFP tagged | 10 ug |
$600.00
|
|
RG219125 | UPP1 (tGFP-tagged) - Human uridine phosphorylase 1 (UPP1), transcript variant 2 | 10 ug |
$489.00
MSRP
$500.00
MSRP
$500.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.