UBE2I (NM_194261) Human Untagged Clone

SKU
SC124667
UBE2I (untagged)-Human ubiquitin-conjugating enzyme E2I (UBE2I), transcript variant 4
$150.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol UBE2I
Synonyms C358B7.1; P18; UBC9
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC124667 sequence for NM_194261 edited (data generated by NextGen Sequencing)
ATGTCGGGGATCGCCCTCAGCAGACTCGCCCAGGAGAGGAAAGCATGGAGGAAAGACCAC
CCATTTGGTTTCGTGGCTGTCCCAACAAAAAATCCCGATGGCACGATGAACCTCATGAAC
TGGGAGTGCGCCATTCCAGGAAAGAAAGGGACTCCGTGGGAAGGAGGCTTGTTTAAACTA
CGGATGCTTTTCAAAGATGATTATCCATCTTCGCCACCAAAATGTAAATTCGAACCACCA
TTATTTCACCCGAATGTGTACCCTTCGGGGACAGTGTGCCTGTCCATCTTAGAGGAGGAC
AAGGACTGGAGGCCAGCCATCACAATCAAACAGATCCTATTAGGAATACAGGAACTTCTA
AATGAACCAAATATCCAAGACCCAGCTCAAGCAGAGGCCTACACGATTTACTGCCAAAAC
AGAGTGGAGTACGAGAAAAGGGTCCGAGCACAAGCCAAGAAGTTTGCGCCCTCATAA

Clone variation with respect to NM_194261.2
Restriction Sites NotI-NotI
ACCN NM_194261
Insert Size 1080 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_194261.1, NP_919237.1
RefSeq Size 1177 bp
RefSeq ORF 477 bp
Locus ID 7329
UniProt ID P63279
Cytogenetics 16p13.3
Protein Pathways Ubiquitin mediated proteolysis
Summary The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. Four alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (4) differs in the 5' UTR, as compared to variant 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:UBE2I (NM_194261) Human Untagged Clone
Your Rating
SKU Description Size Price
RC201199 UBE2I (Myc-DDK-tagged)-Human ubiquitin-conjugating enzyme E2I (UBE2I), transcript variant 4 10 ug
$150.00
RC201199L1 Lenti ORF clone of Human ubiquitin-conjugating enzyme E2I (UBE2I), transcript variant 4, Myc-DDK-tagged 10 ug
$450.00
RC201199L2 Lenti ORF clone of Human ubiquitin-conjugating enzyme E2I (UBE2I), transcript variant 4, mGFP tagged 10 ug
$450.00
RC201199L3 Lenti ORF clone of Human ubiquitin-conjugating enzyme E2I (UBE2I), transcript variant 4, Myc-DDK-tagged 10 ug
$450.00
RC201199L4 Lenti ORF clone of Human ubiquitin-conjugating enzyme E2I (UBE2I), transcript variant 4, mGFP tagged 10 ug
$450.00
RG201199 UBE2I (tGFP-tagged) - Human ubiquitin-conjugating enzyme E2I (UBE2I), transcript variant 4 10 ug
$350.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.