UBE2I (NM_194261) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | UBE2I |
Synonyms | C358B7.1; P18; UBC9 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
Fully Sequenced ORF
>OriGene ORF within SC124667 sequence for NM_194261 edited (data generated by NextGen Sequencing)
ATGTCGGGGATCGCCCTCAGCAGACTCGCCCAGGAGAGGAAAGCATGGAGGAAAGACCAC CCATTTGGTTTCGTGGCTGTCCCAACAAAAAATCCCGATGGCACGATGAACCTCATGAAC TGGGAGTGCGCCATTCCAGGAAAGAAAGGGACTCCGTGGGAAGGAGGCTTGTTTAAACTA CGGATGCTTTTCAAAGATGATTATCCATCTTCGCCACCAAAATGTAAATTCGAACCACCA TTATTTCACCCGAATGTGTACCCTTCGGGGACAGTGTGCCTGTCCATCTTAGAGGAGGAC AAGGACTGGAGGCCAGCCATCACAATCAAACAGATCCTATTAGGAATACAGGAACTTCTA AATGAACCAAATATCCAAGACCCAGCTCAAGCAGAGGCCTACACGATTTACTGCCAAAAC AGAGTGGAGTACGAGAAAAGGGTCCGAGCACAAGCCAAGAAGTTTGCGCCCTCATAA Clone variation with respect to NM_194261.2 |
Restriction Sites | NotI-NotI |
ACCN | NM_194261 |
Insert Size | 1080 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_194261.1, NP_919237.1 |
RefSeq Size | 1177 bp |
RefSeq ORF | 477 bp |
Locus ID | 7329 |
UniProt ID | P63279 |
Cytogenetics | 16p13.3 |
Protein Pathways | Ubiquitin mediated proteolysis |
Summary | The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. Four alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (4) differs in the 5' UTR, as compared to variant 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC201199 | UBE2I (Myc-DDK-tagged)-Human ubiquitin-conjugating enzyme E2I (UBE2I), transcript variant 4 | 10 ug |
$150.00
|
|
RC201199L1 | Lenti ORF clone of Human ubiquitin-conjugating enzyme E2I (UBE2I), transcript variant 4, Myc-DDK-tagged | 10 ug |
$450.00
|
|
RC201199L2 | Lenti ORF clone of Human ubiquitin-conjugating enzyme E2I (UBE2I), transcript variant 4, mGFP tagged | 10 ug |
$450.00
|
|
RC201199L3 | Lenti ORF clone of Human ubiquitin-conjugating enzyme E2I (UBE2I), transcript variant 4, Myc-DDK-tagged | 10 ug |
$450.00
|
|
RC201199L4 | Lenti ORF clone of Human ubiquitin-conjugating enzyme E2I (UBE2I), transcript variant 4, mGFP tagged | 10 ug |
$450.00
|
|
RG201199 | UBE2I (tGFP-tagged) - Human ubiquitin-conjugating enzyme E2I (UBE2I), transcript variant 4 | 10 ug |
$350.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.