BDNF (NM_001709) Human Untagged Clone

CAT#: SC124461

Reviews ()
Write a review

BDNF (untagged)-Human brain-derived neurotrophic factor (BDNF), transcript variant 4



  "NM_001709" in other vectors (6)

Reward yourself with an Amazon® Card when get any 3 cDNA clones.

USD 310.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name BDNF (NM_001709) Human Untagged Clone
Type Human Untagged Clone
Tag Tag Free
Symbol BDNF
Synonyms ANON2; BULN2
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Cell Selection None
Sequence Data
>OriGene ORF within SC124461 sequence for NM_001709 edited (data generated by NextGen Sequencing)
ATGACCATCCTTTTCCTTACTATGGTTATTTCATACTTTGGTTGCATGAAGGCTGCCCCC
ATGAAAGAAGCAAACATCCGAGGACAAGGTGGCTTGGCCTACCCAGGTGTGCGGACCCAT
GGGACTCTGGAGAGCGTGAATGGGCCCAAGGCAGGTTCAAGAGGCTTGACATCATTGGCT
GACACTTTCGAACACGTGATAGAAGAGCTGTTGGATGAGGACCAGAAAGTTCGGCCCAAT
GAAGAAAACAATAAGGACGCAGACTTGTACACGTCCAGGGTGATGCTCAGTAGTCAAGTG
CCTTTGGAGCCTCCTCTTCTCTTTCTGCTGGAGGAATACAAAAATTACCTAGATGCTGCA
AACATGTCCATGAGGGTCCGGCGCCACTCTGACCCTGCCCGCCGAGGGGAGCTGAGCGTG
TGTGACAGTATTAGTGAGTGGGTAACGGCGGCAGACAAAAAGACTGCAGTGGACATGTCG
GGCGGGACGGTCACAGTCCTTGAAAAGGTCCCTGTATCAAAAGGCCAACTGAAGCAATAC
TTCTACGAGACCAAGTGCAATCCCATGGGTTACACAAAAGAAGGCTGCAGGGGCATAGAC
AAAAGGCATTGGAACTCCCAGTGCCGAACTACCCAGTCGTACGTGCGGGCCCTTACCATG
GATAGCAAAAAGAGAATTGGCTGGCGATTCATAAGGATAGACACTTCTTGTGTATGTACA
TTGACCATTAAAAGGGGAAGATAG

Clone variation with respect to NM_001709.4
>OriGene 5' read for NM_001709 unedited
CGTAGCGCCTCGGGCTCCCGGGCCGGACAGAGGAGCCAGCCCGGTGCGCCCCTCCACCTC
CTGCTCGGGGGGCTTTAATGAGACACCCACCGCTGCTGTGGGGCCGGCGGGGAGCAGCAC
CGCGACGGGGACCGGGGCTGGGCGCTGGAGCCAGAATCGGAACCACGATGTGACTCCGCC
GCCGGGGACCCGTGAGGTTTGTGTGGACCCCGAGTTCCACCAGGTGAGAAGAGTGATGAC
CATCCTTTTCCTTACTATGGTTATTTCATACTTTGGTTGCATGAAGGCTGCCCCCATGAA
AGAAGCAAACATCCGAGGACAAGGTGGCTTGGCCTACCCAGGTGTGCGGACCCATGGGAC
TCTGGAGAGCGTGAATGGGCCCAAGGCAGGTTCAAGAGGCTTGACATCATTGGCTGACAC
TTTCGAACACGTGATAGAAGAGCTGTTGGATGAGGACCAGAAAGTTCGGCCCAATGAAGA
AAACATAAGGACGCAGACTTGTACACGTCCCAGGTGATGCTCAGTAGTCAAGTGCCTTTG
GAGCCTCCTCTTCTTTTTCTGCTGGAGGAATACAAAAATTACCTAGATGCTGGAAACATG
TCCATGAGGGTTCGGGGCCACTTTGACCTTGCCCGCCGAGGGCAGCTGACCGTGTCGGAC
AGTTTTAGTGAGTGGGTCACCGGCCGTTAAACAATAGACTGAGTGGACATGTTGGACGGT
ACGGCTCAAACCTTAGTAAGGCCCTGTTTCAAAGGCTACTGAATCTTTCTTTTACAATCC
AGTGTTT
>OriGene 3' read for NM_001709 unedited
CTATGGAACGGCGGCCGCAATCTAGGATCGAGTTTTTTTTTTTTTTTTTTATAATAAAAC
ACGTTTTCATGTTTGTTTTACAGTAAAGAGAAAAAAACCCAGAACCCCCAGATTTTATGT
ACTTTGAAAATATATTTAAAAACATTAAAAATTCTATATTTAAAACATATATTATATGTT
AATTAGTACACTTAAATAGAACTTGTATTTACAATAGGCTTCTGATGCGGTTAAGTTTTA
ATGCCAATTTTTTTCAATAACATAATTATATAAATATACTAAAATACAATAAATATTGTT
TTTTGTTTTACATGGTGAATAATATCTTTACCATAGAGAGAACAAGGCCACAGACATTTA
CTTACATTTTCAATGGGAATCGCCATAAAAAAGCAACAGGCCTGCTGCCATGCATGAAAC
ACTTCTGCCACAAAGAGACCACAGCAAGACTTTAAAAAACAAAACAAAACAGAACAAGAA
CGGACACAACAGAGAGAGATTTTAACAAAATAAATCTTAGGTCAACATAAACCATCAAGC
ATGTGACTGTGATGTATCTTATTGGGTAAAAGAGCCACTGACCACACAATTGCTGGATGT
GTCTCCTATGAAACCACTTAACAGATCTGGCCCTTGCAATCCTTTAAGTTTGTGATGGGG
GGTTGTTTGTTTTAAACTTGCCCCTCAAAAGAAGCTGCCTAAAGTTGACACATACCACAT
ATTCCAAGCATTTCCTTACATATTTAAAATAATTACAAAGATTATATTTTCAAACAACAC
CAAACAAATCTACACTACGTAAAGTCTTTCCTTCTTTAAAGAAGTATTCAGATGGTACTG
GGAAAGACTACCTTAAATGAAACGATTGACAAATTGAAATTTCTTGCTGATGGGATCTTC
ATTCCTGGGGTATGGGCGAAATCNCTCTTTGGCTTATCCTACACCTACTAAGAGCAAGAA
TTGCTGGCGGCTTTCTGAACCTAAAGAGCTGGTCCAGTGGG
Restriction Sites NotI-NotI     
ACCN NM_001709
Insert Size 4200 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001709.3, NP_001700.2
RefSeq Size 3972 bp
RefSeq ORF 744 bp
Locus ID 627
Cytogenetics 11p14.1
Domains NGF
Protein Families Adult stem cells, Druggable Genome, Embryonic stem cells, ES Cell Differentiation/IPS, Induced pluripotent stem cells, Secreted Protein, Transmembrane
Protein Pathways Huntington's disease, MAPK signaling pathway, Neurotrophin signaling pathway
Gene Summary This gene encodes a member of the nerve growth factor family of proteins. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate the mature protein. Binding of this protein to its cognate receptor promotes neuronal survival in the adult brain. Expression of this gene is reduced in Alzheimer's, Parkinson's, and Huntington's disease patients. This gene may play a role in the regulation of the stress response and in the biology of mood disorders. [provided by RefSeq, Nov 2015]
Transcript Variant: This variant (4), also known as VIb or BDNF5, differs in the 5' UTR and represents use of an alternate promoter compared to variant 1. Variants 1, 2, 4, 5, and 7-16 encode the same isoform (a).

Other Versions

Other products for "BDNF"
Frequently bought together (2)
Rabbit Polyclonal Anti-BDNF
    • 200 ul

USD 585.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools