Peroxiredoxin 5 (PRDX5) (NM_181652) Human Untagged Clone
SKU
SC124388
PRDX5 (untagged)-Human peroxiredoxin 5 (PRDX5), nuclear gene encoding mitochondrial protein, transcript variant 3
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | Peroxiredoxin 5 |
Synonyms | ACR1; AOEB166; B166; HEL-S-55; PLP; PMP20; PRDX6; prx-V; PRXV; SBBI10 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
Fully Sequenced ORF
>NCBI ORF sequence for NM_181652, the custom clone sequence may differ by one or more nucleotides
ATGGGACTAGCTGGCGTGTGCGCCCTGAGACGCTCAGCGGGCTATATACTCGTCGGTGGGGCCGGCGGTC AGTCTGCGGCAGCGGCAGCAAGACGGTGCAGTGAAGGAGAGTGGGCGTCTGGCGGGGTCCGCAGTTTCAG CAGAGCCGCTGCAGCCATGGCCCCAATCAAGGTTCGGCTCCTGGCTGATCCCACTGGGGCCTTTGGGAAG GAGACAGACTTATTACTAGATGATTCGCTGGTGTCCATCTTTGGGAATCGACGTCTCAAGAGGTTCTCCA TGGTGGTACAGGATGGCATAGTGAAGGCCCTGAATGTGGAACCAGATGGCACAGGCCTCACCTGCAGCCT GGCACCCAATATCATCTCACAGCTCTGA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_181652 unedited
TTGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGGCTGCGGTGGCACCA GCCAGGAGGCGGAGTGGAAGTGGCCGTGGGGCGGGTATGGGACTAGCTGGCGTGTGCGCC CTGAGACGCTCAGCGGGCTATATACTCGTCGGTGGGGCCGGCGGTCAGTCTGCGGCAGCG GCAGCAAGACGGTGCAGTGAAGGAGAGTGGGCGTCTGGCGGGGTCCGCAGTTTCAGCAGA GCCGCTGCAGCCATGGCCCCAATCAAGGTGGGAGATGCCATCCCAGCAGTGGAGGTGTTT GAAGGGGAGCCAGGGAACAAGGTGAACCTGGCAGAGCTGTTCAAGGGCAAGAAGGGTGTG CTGTTTGGAGTTCCTGGGGCCTTCACCCCTGGATGTTCCAAGACACACCTGCCAGGGTTT GTGGAGCAGGCTGAGGCTCTGAAGGCCAAGGGAGTCCAGGTGGTGGCCTGTCTGAGTGTT AATGATGCCTTTGTGACTGGCGAGTGGGGCCGAGCCCACAAGGCGGAAGGCAAGGTTCGG CTCCTGGCTGATCCCACTGGGGCCTTTGGGAAGGAGACAGACTTATTACTAGATGATTCG CTGGTGTCCATCTTTGGGAATCGACGTCTCAAGAGGTTCTCCATGGTGGTACAGGATGGC ATAGTGAAGGCCCTGAATGTGGAACCAGATGGCACAGGCCTCACCTGCAGCCTGGCACCC AATATCATCTCACAGCTCTTGAGCCCTNGGCCAGATTACTTNCTNCACCCTNCCTATCTC ACTGCCCAGCCTGTGCTGGGGCCCCTGCATGGNAATGTNGCCANATTCTGCNATAACACT TGTGGTTTGCGGCCAAAAAAAAAANNNNNNAAAAAANNNNNNANAAAAAAANNNNAAAAA AAAAAAAACCCCAAAAAA |
Restriction Sites | NotI-NotI |
ACCN | NM_181652 |
Insert Size | 4700 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_181652.1, NP_857635.1 |
RefSeq Size | 692 bp |
RefSeq ORF | 378 bp |
Locus ID | 25824 |
UniProt ID | P30044 |
Cytogenetics | 11q13.1 |
Protein Families | Druggable Genome |
Summary | This gene encodes a member of the peroxiredoxin family of antioxidant enzymes, which reduce hydrogen peroxide and alkyl hydroperoxides. The encoded protein interacts with peroxisome receptor 1 and plays an antioxidant protective role in different tissues under normal conditions and during inflammatory processes. The use of alternate transcription start sites is thought to result in transcript variants that use different in-frame translational start codons to generate isoforms that are targeted to the mitochondrion (isoform L) or peroxisome/cytoplasm (isoform S). Multiple related pseudogenes have been defined for this gene. [provided by RefSeq, Nov 2017] Transcript Variant: This variant (3) lacks two alternate in-frame exons compared to variant 1. The resulting isoform (c) is shorter than isoform L. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC217362 | PRDX5 (Myc-DDK-tagged)-Human peroxiredoxin 5 (PRDX5), nuclear gene encoding mitochondrial protein, transcript variant 3 | 10 ug |
$165.00
|
|
RC217362L1 | Lenti ORF clone of Human peroxiredoxin 5 (PRDX5), nuclear gene encoding mitochondrial protein, transcript variant 3, Myc-DDK-tagged | 10 ug |
$465.00
|
|
RC217362L2 | Lenti ORF clone of Human peroxiredoxin 5 (PRDX5), nuclear gene encoding mitochondrial protein, transcript variant 3, mGFP tagged | 10 ug |
$465.00
|
|
RC217362L3 | Lenti ORF clone of Human peroxiredoxin 5 (PRDX5), nuclear gene encoding mitochondrial protein, transcript variant 3, Myc-DDK-tagged | 10 ug |
$465.00
|
|
RC217362L4 | Lenti ORF clone of Human peroxiredoxin 5 (PRDX5), nuclear gene encoding mitochondrial protein, transcript variant 3, mGFP tagged | 10 ug |
$465.00
|
|
RG217362 | PRDX5 (tGFP-tagged) - Human peroxiredoxin 5 (PRDX5), nuclear gene encoding mitochondrial protein, transcript variant 3 | 10 ug |
$365.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.