JNK1 (MAPK8) (NM_139046) Human Untagged Clone
SKU
SC124375
MAPK8 (untagged)-Human mitogen-activated protein kinase 8 (MAPK8), transcript variant JNK1-b1
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | JNK1 |
Synonyms | JNK; JNK-46; JNK1; JNK1A2; JNK21B1/2; PRKM8; SAPK1; SAPK1c |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
Fully Sequenced ORF
>NCBI ORF sequence for NM_139046, the custom clone sequence may differ by one or more nucleotides
ATGAGCAGAAGCAAGCGTGACAACAATTTTTATAGTGTAGAGATTGGAGATTCTACATTCACAGTCCTGA AACGATATCAGAATTTAAAACCTATAGGCTCAGGAGCTCAAGGAATAGTATGCGCAGCTTATGATGCCAT TCTTGAAAGAAATGTTGCAATCAAGAAGCTAAGCCGACCATTTCAGAATCAGACTCATGCCAAGCGGGCC TACAGAGAGCTAGTTCTTATGAAATGTGTTAATCACAAAAATATAATTGGCCTTTTGAATGTTTTCACAC CACAGAAATCCCTAGAAGAATTTCAAGATGTTTACATAGTCATGGAGCTCATGGATGCAAATCTTTGCCA AGTGATTCAGATGGAGCTAGATCATGAAAGAATGTCCTACCTTCTCTATCAGATGCTGTGTGGAATCAAG CACCTTCATTCTGCTGGAATTATTCATCGGGACTTAAAGCCCAGTAATATAGTAGTAAAATCTGATTGCA CTTTGAAGATTCTTGACTTCGGTCTGGCCAGGACTGCAGGAACGAGTTTTATGATGACGCCTTATGTAGT GACTCGCTACTACAGAGCACCCGAGGTCATCCTTGGCATGGGCTACAAGGAAAACGTTGACATTTGGTCA GTTGGGTGCATCATGGGAGAAATGATCAAAGGTGGTGTTTTGTTCCCAGGTACAGATCATATTGATCAGT GGAATAAAGTTATTGAACAGCTTGGAACACCATGTCCTGAATTCATGAAGAAACTGCAACCAACAGTAAG GACTTACGTTGAAAACAGACCTAAATATGCTGGATATAGCTTTGAGAAACTCTTCCCTGATGTCCTTTTC CCAGCTGACTCAGAACACAACAAACTTAAAGCCAGTCAGGCAAGGGATTTGTTATCCAAAATGCTGGTAA TAGATGCATCTAAAAGGATCTCTGTAGATGAAGCTCTCCAACACCCGTACATCAATGTCTGGTATGATCC TTCTGAAGCAGAAGCTCCACCACCAAAGATCCCTGACAAGCAGTTAGATGAAAGGGAACACACAATAGAA GAGTGGAAAGAATTGATATATAAGGAAGTTATGGACTTGGAGGAGAGAACCAAGAATGGAGTTATACGGG GGCAGCCCTCTCCTTTAGCACAGGTGCAGCAGTGA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_139046 unedited
CTATAGGCGGCACGCGAATTCGCACGAGGGCCGCGAGCAGCGCTGGGTAACGGCCGCGGC GACCACCCCGGACGGCCCCTGTCCCCGCTGGCGGGCTTCCCTGTCGCCGTTCGCTGCGCT GCCGGCTTCTTGGTGAATTTTTGGATGAAGCCATTAAATTAATTGCTTGCCATCATGAGC AGAAGCAAGCGTGACAACAATTTTTATAGTGTAGAGATTGGAGATTCTACATTCACAGTC CTGAAACGATATCAGAATTTAAAACCTATAGGCTCAGGAGCTCAAGGAATAGTATGCGCA GCTTATGATGCCATTCTTGAAAGAAATGTTGCAATCAAGAAGCTAAGCCGACCATTTCAG AATCAGACTCATGCCAAGCGGGCCTACAGAGAGCTAGTTCTTATGAAATGTGTTAATCAC AAAAATATAATTGGCCTTTTGAATGTTTTCACACCACAGAAATCCCTAGAAGAATTTCAA GATGTTTACATAGTCATGGAGCTCATGGATGCAAATCTTTGCCAAGTGATTCAGATGGAG CTAGATCATGAAAGAATGTCCTACCTTCTCTATCAGATGCTGTGTGGAATCAAGCACCTT CATTCTGCTGGAATTATTCATCGGGACTTAAAGCCCAGTAATATAGTAGTAAAATCTGAT TGCACTTTGAAGATTCTTGACTTCGGTCTGGCCAGGACTGCAGGAACGAGTTTTATGATG ACGCCTTATGTAGTGACTCGCTACTACAGAGCACCCGAGGTCATCCTTGGCATGGGCTAC AAGGAAACGTGGATNTATGGTCTGTGGGGTGCATTATGGGAGAAATGGTTTGCCACAAAA TCCTCTTTTCAGNNAAGGACTATATTGATCAGTGGAA |
Restriction Sites | NotI-NotI |
ACCN | NM_139046 |
Insert Size | 5000 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_139046.1, NP_620634.1 |
RefSeq Size | 1417 bp |
RefSeq ORF | 1155 bp |
Locus ID | 5599 |
UniProt ID | P45983 |
Cytogenetics | 10q11.22 |
Protein Families | Druggable Genome, ES Cell Differentiation/IPS, Protein Kinase |
Protein Pathways | Adipocytokine signaling pathway, Colorectal cancer, Epithelial cell signaling in Helicobacter pylori infection, ErbB signaling pathway, Fc epsilon RI signaling pathway, Focal adhesion, GnRH signaling pathway, Insulin signaling pathway, MAPK signaling pathway, Neurotrophin signaling pathway, NOD-like receptor signaling pathway, Pancreatic cancer, Pathways in cancer, Progesterone-mediated oocyte maturation, RIG-I-like receptor signaling pathway, Toll-like receptor signaling pathway, Type II diabetes mellitus, Wnt signaling pathway |
Summary | The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. This kinase is activated by various cell stimuli, and targets specific transcription factors, and thus mediates immediate-early gene expression in response to cell stimuli. The activation of this kinase by tumor-necrosis factor alpha (TNF-alpha) is found to be required for TNF-alpha induced apoptosis. This kinase is also involved in UV radiation induced apoptosis, which is thought to be related to cytochrom c-mediated cell death pathway. Studies of the mouse counterpart of this gene suggested that this kinase play a key role in T cell proliferation, apoptosis and differentiation. Several alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Apr 2016] Transcript Variant: This variant (JNK1-b1) uses a different acceptor splice site in the last coding exon compared to transcript variant JNK1-b2, resulting in a frameshift and a shorter isoform (JNK1 beta1) with a different C-terminus, compared to isoform JNK1 beta2. The JNK1-b1 variant differs from the JNK1-a1 variant in the use of an alternate internal coding exon of the same length. Thus, JNK1 beta1 isoform is the same length as JNK1 alpha1 isoform, with a few aa difference in an internal protein segment. Variants JNK1-b1, 7, and 11 all encode isoform beta1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC222829 | MAPK8 (Myc-DDK-tagged)-Human mitogen-activated protein kinase 8 (MAPK8), transcript variant JNK1-b1 | 10 ug |
$457.00
|
|
RC222829L1 | Lenti ORF clone of Human mitogen-activated protein kinase 8 (MAPK8), transcript variant JNK1-b1, Myc-DDK-tagged | 10 ug |
$757.00
|
|
RC222829L2 | Lenti ORF clone of Human mitogen-activated protein kinase 8 (MAPK8), transcript variant JNK1-b1, mGFP tagged | 10 ug |
$757.00
|
|
RC222829L3 | Lenti ORF clone of Human mitogen-activated protein kinase 8 (MAPK8), transcript variant JNK1-b1, Myc-DDK-tagged | 10 ug |
$757.00
|
|
RC222829L4 | Lenti ORF clone of Human mitogen-activated protein kinase 8 (MAPK8), transcript variant JNK1-b1, mGFP tagged | 10 ug |
$757.00
|
|
RG222829 | MAPK8 (tGFP-tagged) - Human mitogen-activated protein kinase 8 (MAPK8), transcript variant JNK1-b1 | 10 ug |
$657.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.