MelanA (MLANA) (NM_005511) Human Untagged Clone

SKU
SC121165
MLANA (untagged)-Human melan-A (MLANA)
$150.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol MelanA
Synonyms MART-1; MART1
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>SC121165 representing NM_005511.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCCAAGAGAAGATGCTCACTTCATCTATGGTTACCCCAAGAAGGGGCACGGCCACTCTTACACCACG
GCTGAAGAGGCCGCTGGGATCGGCATCCTGACAGTGATCCTGGGAGTCTTACTGCTCATCGGCTGTTGG
TATTGTAGAAGACGAAATGGATACAGAGCCTTGATGGATAAAAGTCTTCATGTTGGCACTCAATGTGCC
TTAACAAGAAGATGCCCACAAGAAGGGTTTGATCATCGGGACAGCAAAGTGTCTCTTCAAGAGAAAAAC
TGTGAACCTGTGGTTCCCAATGCTCCACCTGCTTATGAGAAACTCTCTGCAGAACAGTCACCACCACCT
TATTCACCTTAA

5' Read Nucleotide Sequence
>OriGene 5' read for NM_005511 unedited
GCGGCCGCGAATTCGGCACGAGGGCAGTCTTCATACACGCGGCCAGCCAGCAGACAGAGGACTCTCATT
AAGGAAGGTGTCCTGTGCCCTGACCCTACAAG
3' Read Nucleotide Sequence
>OriGene 3' read for NM_005511 unedited
GAGCCAGCGAGACACCTGAGACATGCTGAAATTATTTCTCTCACACTTTTGCTTGAATTTAATACAGAC
ATCTAATGTTCTCCTTTGGAATGGTGTAGGAAAAATGCAAGCCATCTCTAATAATAAGTCAGTGTTAAA
ATTTTAGTAGGTCCGCTAGCAGTACTAATCATGTGAGGAAATGATGAGAAATATTAAATTGGGAAAACT
CCATCAATAAATGTTGCAATGCATGATACTAAAAAAAAAAAAAAAAAACTCGACTCTAGATTGCGGCCGC
Restriction Sites NotI-NotI
ACCN NM_005511
Insert Size 357 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_005511.1
RefSeq Size 1524 bp
RefSeq ORF 357 bp
Locus ID 2315
UniProt ID Q16655
Cytogenetics 9p24.1
Protein Families Transmembrane
MW 13.2 kDa
Summary Involved in melanosome biogenesis by ensuring the stability of GPR143. Plays a vital role in the expression, stability, trafficking, and processing of melanocyte protein PMEL, which is critical to the formation of stage II melanosomes.[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:MelanA (MLANA) (NM_005511) Human Untagged Clone
Your Rating
SKU Description Size Price
RC204190 MLANA (Myc-DDK-tagged)-Human melan-A (MLANA) 10 ug
$150.00
RC204190L1 Lenti ORF clone of Human melan-A (MLANA), Myc-DDK-tagged 10 ug
$450.00
RC204190L2 Lenti ORF clone of Human melan-A (MLANA), mGFP tagged 10 ug
$450.00
RC204190L3 Lenti ORF clone of Human melan-A (MLANA), Myc-DDK-tagged 10 ug
$450.00
RC204190L4 Lenti ORF clone of Human melan-A (MLANA), mGFP tagged 10 ug
$450.00
RG204190 MLANA (tGFP-tagged) - Human melan-A (MLANA) 10 ug
$489.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.