NDUFA11 (NM_175614) Human Untagged Clone

SKU
SC120963
NDUFA11 (untagged)-Human NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 11, 14.7kDa (NDUFA11), nuclear gene encoding mitochondrial protein, transcript variant 1
$150.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol NDUFA11
Synonyms B14.7; CI-B14.7; MC1DN14
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC120963 sequence for NM_175614 edited (data generated by NextGen Sequencing)
ATGGCGCCGAAGGTTTTTCGTCAGTACTGGGATATCCCCGATGGCACCGATTGCCACCGC
AAAGCCTACAGCACCACCAGTATTGCCAGCGTCGCTGGCCTGACCGCCGCTGCCTACAGA
GTCACACTCAATCCTCCGGGCACCTTCCTTGAAGGAGTGGCTAAGGTTGGACAATACACG
TTCACTGCAGCTGCTGTCGGGGCCGTGTTTGGCCTCACCACCTGCATCAGCGCCCATGTC
CGCGAGAAGCCCGACGACCCCCTGAACTACTTCCTCGGTGGCTGCGCCGGAGGCCTGACT
CTGGGAGCACGCACGCACAACTACGGGATTGGCGCCGCCGCCTGCGTGTACTTTGGCATA
GCGGCCTCCCTGGTCAAGATGGGCCGGCTGGAGGGCTGGGAGGTGTTTGCAAAACCCAAG
GTGTGA

Clone variation with respect to NM_175614.4
5' Read Nucleotide Sequence
>OriGene 5' read for NM_175614 unedited
ATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGCCGTGGTGCGGGATCGAGAT
TGCGGGCTATGGCGCCGAAGGTTTTTCGTCAGTACTGGGATATCCCCGATGGCACCGATT
GCCACCGCAAAGCCTACAGCACCACCAGTATTGCCAGCGTCGCTGGCCTGACCGCCGCTG
CCTACAGAGTCACACTCAATCCTCCGGGCACCTTCCTTGAAGGAGTGGCTAAGGTTGGAC
AATACACGTTCACTGCAGCTGCTGTCGGGGCCGTGTTTGGCCTCACCACCTGCATCAGCG
CCCATGTCCGCGAGAAGCCCGACGACCCCCTGAACTACTTCCTCGGTGGCTGCGCCGGAG
GCCTGACTCTGGGAGCACGCACGCACAACTACGGGATTGGCGCCGCCGCCTGCGTGTACT
TTGGCATAGCGGCCTCCCTGGTCAAGATGGGCCGGCTGGAGGGCTGGGAGGTGTTTGCAA
AACCCAAGGTGTGAGCCCTGTGCCTGCCGGGACCTCCAGCCTGCAGAATGCGTCCAGAAA
TAAATTCTGTGTCTGTGTGAAAAANAAAAAAAAAAAACTCGACTCTAGATTGCGGCCGCG
GTCATAGCTGTTTCCTGAACAGATCCCGGGTGGCATCCCTGTGACCNCTCCCCAGTGCCT
CTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCA
Restriction Sites NotI-NotI
ACCN NM_175614
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_175614.2, NP_783313.1
RefSeq Size 819 bp
RefSeq ORF 426 bp
Locus ID 126328
UniProt ID Q86Y39
Cytogenetics 19p13.3
Protein Families Transmembrane
Protein Pathways Metabolic pathways, Oxidative phosphorylation
Summary This gene encodes a subunit of the membrane-bound mitochondrial complex I. Complex I is composed of numerous subunits and functions as the NADH-ubiquinol reductase of the mitochondrial electron transport chain. Mutations in this gene are associated with severe mitochondrial complex I deficiency. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Oct 2010]
Transcript Variant: This variant (1) is a dominant transcript and encodes isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:NDUFA11 (NM_175614) Human Untagged Clone
Your Rating
SKU Description Size Price
RC208966 NDUFA11 (Myc-DDK-tagged)-Human NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 11, 14.7kDa (NDUFA11), nuclear gene encoding mitochondrial protein, transcript variant 1 10 ug
$150.00
RC208966L3 Lenti ORF clone of Human NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 11, 14.7kDa (NDUFA11), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged 10 ug
$450.00
RC208966L4 Lenti ORF clone of Human NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 11, 14.7kDa (NDUFA11), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged 10 ug
$450.00
RG208966 NDUFA11 (tGFP-tagged) - Human NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 11, 14.7kDa (NDUFA11), nuclear gene encoding mitochondrial protein, transcript variant 1 10 ug
$489.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.