GBA (NM_000157) Human Untagged Clone

CAT#: SC120080

GBA (untagged)-Human glucosidase, beta, acid (GBA), transcript variant 1

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name GBA (NM_000157) Human Untagged Clone
Symbol GBA
Synonyms GBA1; GCB; GLUC
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC120080 sequence for NM_000157 edited (data generated by NextGen Sequencing)
ATGGAGTTTTCAAGTCCTTCCAGAGAGGAATGTCCCAAGCCTTTGAGTAGGGTAAGCATC
ATGGCTGGCAGCCTCACAGGATTGCTTCTACTTCAGGCAGTGTCGTGGGCATCAGGTGCC
CGCCCCTGCATCCCTAAAAGCTTCGGCTACAGCTCGGTGGTGTGTGTCTGCAATGCCACA
TACTGTGACTCCTTTGACCCCCCGACCTTTCCTGCCCTTGGTACCTTCAGCCGCTATGAG
AGTACACGCAGTGGGCGACGGATGGAGCTGAGTATGGGGCCCATCCAGGCTAATCACACG
GGCACAGGCCTGCTACTGACCCTGCAGCCAGAACAGAAGTTCCAGAAAGTGAAGGGATTT
GGAGGGGCCATGACAGATGCTGCTGCTCTCAACATCCTTGCCCTGTCACCCCCTGCCCAA
AATTTGCTACTTAAATCGTACTTCTCTGAAGAAGGAATCGGATATAACATCATCCGGGTA
CCCATGGCCAGCTGTGACTTCTCCATCCGCACCTACACCTATGCAGACACCCCTGATGAT
TTCCAGTTGCACAACTTCAGCCTCCCAGAGGAAGATACCAAGCTCAAGATACCCCTGATT
CACCGAGCCCTGCAGTTGGCCCAGCGTCCCGTTTCACTCCTTGCCAGCCCCTGGACATCA
CCCACTTGGCTCAAGACCAATGGAGCGGTGAATGGGAAGGGGTCACTCAAGGGACAGCCC
GGAGACATCTACCACCAGACCTGGGCCAGATACTTTGTGAAGTTCCTGGATGCCTATGCT
GAGCACAAGTTACAGTTCTGGGCAGTGACAGCTGAAAATGAGCCTTCTGCTGGGCTGTTG
AGTGGATACCCCTTCCAGTGCCTGGGCTTCACCCCTGAACATCAGCGAGACTTCATTGCC
CGTGACCTAGGTCCTACCCTCGCCAACAGTACTCACCACAATGTCCGCCTACTCATGCTG
GATGACCAACGCTTGCTGCTGCCCCACTGGGCAAAGGTGGTACTGACAGACCCAGAAGCA
GCTAAATATGTTCATGGCATTGCTGTACATTGGTACCTGGACTTTCTGGCTCCAGCCAAA
GCCACCCTAGGGGAGACACACCGCCTGTTCCCCAACACCATGCTCTTTGCCTCAGAGGCC
TGTGTGGGCTCCAAGTTCTGGGAGCAGAGTGTGCGGCTAGGCTCCTGGGATCGAGGGATG
CAGTACAGCCACAGCATCATCACGAACCTCCTGTACCATGTGGTCGGCTGGACCGACTGG
AACCTTGCCCTGAACCCCGAAGGAGGACCCAATTGGGTGCGTAACTTTGTCGACAGTCCC
ATCATTGTAGACATCACCAAGGACACGTTTTACAAACAGCCCATGTTCTACCACCTTGGC
CACTTCAGCAAGTTCATTCCTGAGGGCTCCCAGAGAGTGGGGCTGGTTGCCAGTCAGAAG
AACGACCTGGACGCAGTGGCACTGATGCATCCCGATGGCTCTGCTGTTGTGGTCGTGCTA
AACCGCTCCTCTAAGGATGTGCCTCTTACCATCAAGGATCCTGCTGTGGGCTTCCTGGAG
ACAATCTCACCTGGCTACTCCATTCACACCTACCTGTGGCGTCGCCAGTGA

Clone variation with respect to NM_000157.3
5' Read Nucleotide Sequence
>OriGene 5' read for NM_000157 unedited
AACATTTTGTAATACGACTTACTATAGGGCGCTCNCGCGAATTCGCACGAGGCTAGTGCC
TATAGCTAAGGCAGGTACCTGCATCCTTGTTTTTGTTTAGTGGATCCTCTATCCTTCAGA
GACTCTGGAACCCCTGTGGTCTTCTCTTCATCTAATGACCCTGAGGGGATGGAGTTTTCA
AGTCCTTCCAGAGAGGAATGTCCCAAGCCTTTGAGTAGGGTAAGCATCATGGCTGGCAGC
CTCACAGGATTGCTTCTACTTCAGGCAGTGTCGTGGGCATCAGGTGCCCGCCCCTGCATC
CCTAAAAGCTTCGGCTACAGCTCGGTGGTGTGTGTCTGCAATGCCACATACTGTGACTCC
TTTGACCCCCCGACCTTTCCTGCCCTTGGTACCTTCAGCCGCTATGAGAGTACACGCAGT
GGGCGACGGATGGAGCTGAGTATGGGGCCCATCCAGGCTAATCACACGGGCACAGGCCTG
CTACTGACCCTGCAGCCAGAACAGAAGTTCCAGAAAGTGAAGGGATTTGGAGGGGCCATG
ACAGATGCTGCTGCTCTCAACATCCTTGCCCTGTCACCCCCTGCCCAAAATTTGCTACTT
AAATCGTACTTCTCTGAAGAAGGAATCGGATATAACATCATCCGGGTACCCATGGCCAGC
TGTGACTTCTCCATCCGCACCTACACCTATGCAGACACCCCTGATGATTTCCAGTTGCAC
AACTTCAGCCTCCCAGAGGAAGATACCAAGCTCAAGATACCCCTGATTCACCGAGCCCTG
CANGTGGCCCAGCGTCCCCGTTCACTCCTTGCCAGCCCCTGGACATCACCCACTTGGNCT
CAAGACCATGGAGCGGTGAATGGGAAGGGGTCACTNCAGGGACAGNCCGNAGACATCTAC
ACCAGACCTGNGCCAGAACTTTGTGAAGTCCTGGATGCTATGCTGAGCCAGTTACANGTC
TGGGCN
3' Read Nucleotide Sequence
>OriGene 3' read for NM_000157 unedited
AACCTAGCTCAACTTTTCTCTTTAANACTGCCTTTTTCCTGGCTGGTGCCATAGGAATCA
TCTGGGTGCCTGGGCACACCCGCTGCTGCTTTAAGGCTTCCGCCCTGATGCTGACACTGC
TGCTCCACGGGCCCAGTTCTGCATCTCCAGGAAAGACAAACAGTCTCCAGTTTTGGGCCC
AGCTTTCCTAGTCTCTTCTTTTCCTTACCCTCAGCCCTGATCTTGTGTTTGTACGGACAG
TGAGCTCACCCTAGGCCTGGACCCAGGCCCAGTTTCCAAAGCAAGCAGCACACAGCGCAT
GTTCACATAAGCATGGGGGCTGGGGGGACACTGGGGCTTACTGATCTTTTTCTAGGGGCC
TCCAGCCCCTGGCACCACCTAGAGGGGAAAGTGAGTCACCCAAACCATTGCCCCTGGGCT
TACGTCGCTGTAAGCTCACACTGGCCCTGCTGTGCCCTCTTTAGTCACAGACAGCGTGTG
AGCTGACTCTGTCCCTTTAATGCCCAGGCTGAGCCCAGTGCCTCCTTGAGTATCTGCTCC
ATCACTGGCGACGCCACAGGTAGGTGTGAATGGAGTAGCCAGGTGAGATTGTCTCCAGGA
AGCCCACAGCAGGATCCTTGATGGTAAGAGGCACATTCTTAGAGGAGCGGTTTAGCACGA
CCACAACAGCAGAGCCATCGGGATGCATCAGTGCCACTGCGTCCAGGTCGTTCTTCTGAC
TGGCAACCAGCCCCACTCTCTGGGAGCCCTCAGGAATGAACTTGCTGAAGTGGCCAAGGT
GGTAGAACATGGGCTGTTNTGTAAACGTGTCCTTGGTGATGTCTACAATGATGGGACTGT
CGACNAATTACGCCCCCATTGGGTCCTCCTTCGGGTTCAGGGCAGGTTCNCAGTCGNTCA
GCCGACCCATGTACAGGAGTTCGG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_000157
ORF Size 1611 bp
Insert Size 2290
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_000157.2, NP_000148
RefSeq Size 2324
RefSeq ORF 1611
Locus ID 2629
Cytogenetics 1q22
Domains Glyco_hydro_30
Protein Families Druggable Genome
Protein Pathways Other glycan degradation, Sphingolipid metabolism, Metabolic pathways, Lysosome
Gene Summary This gene encodes a lysosomal membrane protein that cleaves the beta-glucosidic linkage of glycosylceramide, an intermediate in glycolipid metabolism. Mutations in this gene cause Gaucher disease, a lysosomal storage disease characterized by an accumulation of glucocerebrosides. A related pseudogene is approximately 12 kb downstream of this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]
Transcript Variant: This variant (1) encodes isoform 1. Variants 1, 2 and 3 encode the same isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.