APRT (NM_000485) Human Untagged Clone

CAT#: SC119854

Reviews ()
Write a review

APRT (untagged)-Human adenine phosphoribosyltransferase (APRT), transcript variant 1



  "NM_000485" in other vectors (4)

USD 420.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name APRT (NM_000485) Human Untagged Clone
Type Human Untagged Clone
Tag Tag Free
Symbol APRT
Synonyms AMP; APRTD
Vector pCMV6-XL6
E. coli Selection Ampicillin (100 ug/mL)
Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_000485, the custom clone sequence may differ by one or more nucleotides


ATGGCCGACTCCGAGCTGCAGCTGGTTGAGCAGCGGATCCGCAGCTTCCCCGACTTCCCCACCCCAGGCG
TGGTATTCAGGGACATCTCGCCCGTCCTGAAGGACCCCGCCTCCTTCCGCGCCGCCATCGGCCTCCTGGC
GCGACACCTGAAGGCGACCCACGGGGGCCGCATCGACTACATCGCAGGCCTAGACTCCCGAGGCTTCCTC
TTTGGCCCCTCCCTGGCCCAGGAGCTTGGACTGGGCTGCGTGCTCATCCGAAAGCGGGGGAAGCTGCCAG
GCCCCACTCTGTGGGCCTCCTATTCCCTGGAGTACGGGAAGGCTGAGCTGGAGATTCAGAAAGACGCCCT
GGAGCCAGGACAGAGGGTGGTCGTCGTGGATGATCTGCTGGCCACTGGTGGAACCATGAACGCTGCCTGT
GAGCTGCTGGGCCGCCTGCAGGCTGAGGTCCTGGAGTGCGTGAGCCTGGTGGAGCTGACCTCGCTTAAGG
GCAGGGAGAAGCTGGCACCTGTACCCTTCTTCTCTCTCCTGCAGTATGAGTGA


>OriGene 5' read for NM_000485 unedited
GCGCCCCGTTGCCGCATATGGGCGGTAGCGTGTACGGTGGGAGGTCTATATAAGCAGAGC
TCATTTAGGTGACACTATAGAATACAAGCTACTTGTTCTTTTTGCAGCGGCCGCGAATTC
GGCACGAGGGGGCTGCCGCTGGCTCTTCGCACGCGGCCATGGCCGACTCCGAGCTGCAGC
TGGTTGAGCAGCGGATCCGCAGCTTCCCCGACTTCCCCACCCCAGGCGTGGTATTCAGGG
ACATCTCGCCCGTCCTGAAGGACCCCGCCTCCTTCCGCGCCGCCATCGGCCTCCTGGCGC
GACACCTGAAGGCGACCCACGGGGGCCGCATCGACTACATCGCAGGCTGAGCTGGAGATT
CAGAAAGACGCCCTGGAGCCAGGACAGAGGGTGGTCGTCGTGGATGATCTGCTGGCCACT
GGTGGAACCATGAACGCTGCCTGTGAGCTGCTGGGCCGCCTGCAGGCTGAGGTCCTGGAG
TGCGTGAGCCTGGTGGAGCTGACCTCGCTTAAGGGCAGGGAGAAGCTGGCACCTGTACCC
TTCTTCTCTCTCCTGCAGTATGAGTGACCACAGGGCCTCCCAGCCCAACATCTCCAGCTG
GATCCCAGGGAAATATCAGCCTTGGGCAACTGCAGTGACCAGGGGCACCGGCTGCCCACA
GGGAACACATTCCTTTGCTGGGGTTCAGCGCCTCTCCTGNGGCTGGAAGTGCCAAAGCCT
GGGGCANAGCTGTGTTTCAGCCACACTGAACCCAATTACACACAGCGGGAGAACGCAGTA
NACAGCTTTCCCNACAAAAAAAAAAAAAAAAAAAAAACTCGACTCTAGATTGCGGCCGCG
GTCATAGCTGTTNCCCTGACAGATCCCGGGTGGGCATCCTGTGACCCCTCCCAGTGCCTC
TCCTGGCCCTGNNANNNTGCACTCAGTGCCCACCACCNTNNGTCTATAAANTAAGTGCAT
CATTTGTCTGACTAGTGTCCTCATAATATATGG
>OriGene 3' read for NM_000485 unedited
TTAGTTTTAAAACCTTTTTTTTTTTTTTTTGGGGGGATTTCTGTTTACTGCGTTCTCCCG
CTGTGTGTAATTGGGTTCAGTGTGGCTGAAACACAGCTTTGCCCCAGGCTTTGGCACTTC
CAGCCCCAGGAGAGGCGCTGAACCCCAGCAAAGGAATGTGTTCCCTGTGGGCAGCCGGTG
CCCCTGGTCACTGCAGTTGCCCAAGGCTGATATTTCCCTGGGATCCAGCTGGAGATGTTG
GGCTGGGAGGCCCTGTGGTCACTCATACTGCAGGAGAGAGAAGAAGGGTACAGGTGCCAG
CTTCTCCCTGCCCTTAAGCGAGGTCAGCTCCACCAGGCTCACGCACTCCAGGACCTCAGC
CTGCAGGCGGCCCAGCAGCTCACAGGCAGCGTTCATGGTTCCACCAGTGGCCAGCAGATC
ATCCACGACGACCACCCTCTGTCCTGGCTCCAGGGCGTCTTTCTGAATCTCCAGCTCAGC
CTGCGATGTAGTCGATGCGGCCCCCGTGGGTCGCCTTCAGGTGTCGCGCCAGGAGGCCGA
TGGCGGCGCGGAAAGAGGCGGNGTCCTTCAGGACGGGCGAGATGTCCCTGAATACCACGC
CTGGGGTGGGGAAGTCGGGGAAGCTGCGGATCCGCTGCTCAACCAGCTGCAGCTCGGAGT
CGGCCATGGGCGCGTGCGAAGAGCCAGCGGCAGCCCCCCTCGTGCCGAATTCGCGGCCGC
TGCANAAAGAACAGTAGCCTGTATTCTATAGTGTCACCTAAATGAGCTCTGGCTATATAG
ACCTNCCACCGTACACGCCTTACCGCCCATTTGCGGTCACGGGGNCGGGGGTATTACGAC
ATTTTGGAAAGTCCCGGTGATTTTT
Restriction Sites NotI-NotI     
ACCN NM_000485
Insert Size 800 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_000485.2, NP_000476.1
RefSeq Size 807 bp
RefSeq ORF 543 bp
Locus ID 353
Cytogenetics 16q24.3
Domains Pribosyltran
Protein Families Druggable Genome
Protein Pathways Metabolic pathways, Purine metabolism
Gene Summary Adenine phosphoribosyltransferase belongs to the purine/pyrimidine phosphoribosyltransferase family. A conserved feature of this gene is the distribution of CpG dinucleotides. This enzyme catalyzes the formation of AMP and inorganic pyrophosphate from adenine and 5-phosphoribosyl-1-pyrophosphate (PRPP). It also produces adenine as a by-product of the polyamine biosynthesis pathway. A homozygous deficiency in this enzyme causes 2,8-dihydroxyadenine urolithiasis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (a).

Other Versions

Other products for "APRT"
Frequently bought together (2)
Rabbit polyclonal APRT Antibody (N-term)
    • 400 ul

USD 465.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Molbio tools