CD4 (NM_000616) Human Untagged Clone

CAT#: SC119790

CD4 (untagged)-Human CD4 molecule (CD4), transcript variant 1

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name CD4 (NM_000616) Human Untagged Clone
Symbol CD4
Synonyms CD4mut; CD4mut
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_000616 edited
GAATTCGGCACGAGGCAGAGCTCCAAGTCCTCACACAGATACGCCTGTTTGAGAAGCAGC
GGGCAAGAAAGACGCAAGCCCAGAGGCCCTGCCATTTCTGTGGGCTCAGGTCCCTACTGG
CTCAGGCCCCTGCCTCCCTCGGCAAGGCCACAATGAACCGGGGAGTCCCTTTTAGGCACT
TGCTTCTGGTGCTGCAACTGGCGCTCCTCCCAGCAGCCACTCAGGGAAAGAAAGTGGTGC
TGGGCAAAAAAGGGGATACAGTGGAACTGACCTGTACAGCTTCCCAGAAGAAGAGCATAC
AATTCCACTGGAAAAACTCCAACCAGATAAAGATTCTGGGAAATCAGGGCTTCTTCTTAA
CTAAAGGTCCATCCAAGCTGAATGATCGCGCTGACTCAAGAAGAAGCCTTTGGGACCAAG
GAAACTTTCCCCTGATCATCAAGAATCTTAAGATAGAAGACTCAGATACTTACATCTGTG
AAGTGGAGGACCAGAAGGAGGAGGTGCAATTGCTAGTGTTCGGATTGACTGCCAACTCTG
ACACCCACCTGCTTCAGGGGCAGAGCCTGACCCTGACCTTGGAGAGCCCCCCTGGTAGTA
GCCCCTCAGTGCAATGTAGGAGTCCAAGGGGTAAAAACATACAGGGGGGGAAGACCCTCT
CCGTGTCTCAGCTGGAGCTCCAGGATAGTGGCACCTGGACATGCACTGTCTTGCAGAACC
AGAAGAAGGTGGAGTTCAAAATAGACATCGTGGTGCTAGCTTTCCAGAAGGCCTCCAGCA
TAGTCTATAAGAAAGAGGGGGAACAGGTGGAGTTCTCCTTCCCACTCGCCTTTACAGTTG
AAAAGCTGACGGGCAGTGGCGAGCTGTGGTGGCAGGCGGAGAGGGCTTCCTCCTCCAAGT
CTTGGATCACCTTTGACCTGAAGAACAAGGAAGTGTCTGTAAAACGGGTTACCCAGGACC
CTAAGCTCCAGATGGGCAAGAAGCTCCCGCTCCACCTCACCCTGCCCCAGGCCTTGCCTC
AGTATGCTGGCTCTGGAAACCTCACCCTGGCCCTTGAAGCGAAAACAGGAAAGTTGCATC
AGGAAGTGAACCTGGTGGTGATGAGAGCCACTCAGCTCCAGAAAAATTTGACCTGTGAGG
TGTGGGGACCCACCTCCCCTAAGCTGATGCTGAGTTTGAAACTGGAGAACAAGGAGGCAA
AGGTCTCGAAGCGGGAGAAGGCGGTGTGGGTGCTGAACCCTGAGGCGGGGATGTGGCAGT
GTCTGCTGAGTGACTCGGGACAGGTCCTGCTGGAATCCAACATCAAGGTTCTGCCCACAT
GGTCCACCCCGGTGCAGCCAATGGCCCTGATTGTGCTGGGGGGCGTCGCCGGCCTCCTGC
TTTTCATTGGGCTAGGCATCTTCTTCTGTGTCAGGTGCCGGCACCGAAGGCGCCAAGCAG
AGCGGATGTCTCAGATCAAGAGACTCCTCAGTGAGAAGAAGACCTGCCAGTGTCCTCACC
GGTTTCAGAAGACATGTAGCCCCATTTGAGGCACGAGGCCAGGCAGATCCCACTTGCAGC
CTCCCCAGGTGTCTGCCCCGCGTTTCCTGCCTGCGGACCAGATGAATGTAGCAGATCCCA
GGCCTCTGGCCTCCTGTTCGCCTCCTCTACAATTTGCCATTGTTTCTCCTGGGTTAGGCC
CCGGCTTCACTGGTTGAGTGTTGCTCTCTAGTTTCCAGAGGCTTAATCACACCGTCCTCC
ACGCCATTTCCTTTTCCTTCAAGCCTAGCCCTTCTCTCATCATTTCTCTCTGACCCTCTC
CCCACTGCTCATTTGGATCCCAGGGGAGTGTTCAGGGCCAGCCCTGGCTGGCATGGAGGG
TGAGGCTGGGTGTCTGGAAGCATGGAGCATGGGACTGTTCTTTTACAAGACAGGACCCTG
GGACCACAGAGGGCAGGAACTTGCACAAAATCACACAGCCAAGCCAGTCAAGGATGGATG
CAGATCCAGAGGTTTCTGGCAGCCAGTACCTCCTGCCCCATGCTGCCCGCTTCTCACCCT
ATGTGGGTGGGGCCACAGACTCACATCCTGACCTTGCACAAACAGCCCCTCTGGACACAG
CCCCATGTACACGGCCTCAAGGGATGTCTCACATCCTCTGTCTATTTGAGACTTAGAAAA
ATCCTACAAGGCTGGCAGTGACAGAACTAAGATGATCATCTCCAGTTTATAGACCAGAAC
CAGAGCTCAGAGAGGCTAGATGATTGATTACCAAGTGCCGGACTAGCAAGTGCTGGAGTC
GGGACTAACCCAGGTCCCTTGTCCCAAGTTCCACTGCTGCCTCTTGAATGCAGGGACAAA
TGCCACACGGCTCTCACCAGTGGCTAGTGGTGGGTACTCAATGTGTACTTTTGGGTTCAC
AGAAGCACAGCACCCATGGGAAGGGTCCATCTCAGAGAATTTACGAGCAGGGATGAAGGC
CTCCCTGTCTAAAATCCCTCCTTCATCCCCCGCTGGTGGCAGAATCTGTTACCAGAGGAC
AAAGCCTTTGGCTCTTCTAATCAGAGCGCAAGCTGGGAGCACAGGCACTGCAGGAGAGAA
TGCCCAGTGACCAGTCACTGACCCTGTGCAGAACCTCCTGGAAGCGAGCTTTGCTGGGAG
AGGGGGTAGCTAGCCTGAGAGGGAACCCTCTAAGGGACCTCAAAGGTGATTGTGCCAGGC
TCTGCGCCTGCCCCACACCCTCCCTTACCCTCCTCCAGACCATTCAGGACACAGGGAAAT
CAGGGTTACAAATCTTCTTGATCCACTTCTCTCAGGATCCCCTCTCTTCCTACCCTTCCT
CACCACTTCCCTCAGTCCCAACTCCTTTTCCCTATTTCCTTCTCCTCCTGTCTTTAAAGC
CTGCCTCTTCCAGGAAGACCCCCCTATTGCTGCTGGGGCTCCCCATTTGCTTACTTTGCA
TTTGTGCCCACTCTCCACCCCTGCTCCCCTGAGCTGAAATAAAAATACAATAAACTTACT
ATAAAGATGAAAAAAAAAAAAAAAAAACTCGAC
5' Read Nucleotide Sequence
>OriGene 5' read for NM_000616 unedited
GGTTCAAATTTGTATACGACTCACTATAGGCGGCCGCGAATCGGCACGAGGCAGAGCTCC
AAGTCCTCACACAGATACGCCTGTTTGAGAAGCAGCGGGCAAGAAAGACGCAAGCCCAGA
GGCCCTGCCATTTCTGTGGGCTCAGGTCCCTACTGGCTCAGGCCCCTGCCTCCCTCGGCA
AGGCCACAATGAACCGGGGAGTCCCTTTTAGGCACTTGCTTCTGGTGCTGCAACTGGCGC
TCCTCCCAGCAGCCACTCAGGGAAAGAAAGTGGTGCTGGGCAAAAAAGGGGATACAGTGG
AACTGACCTGTACAGCTTCCCAGAAGAAGAGCATACAATTCCACTGGAAAAACTCCAACC
AGATAAAGATTCTGGGAAATCAGGGCTTCTTCTTAACTAAAGGTCCATCCAAGCTGAATG
ATCGCGCTGACTCAAGAAGAAGCCTTTGGGACCAAGGAAACTTTCCCCTGATCATCAAGA
ATCTTAAGATAGAAGACTCAGATACTTACATCTGTGAAGTGGAGGACCAGAAGGAGGAGG
TGCAATTGCTAGTGTTCGGATTGACTGCCAACTCTGACACCCACCTGCTTCAGGGGCAGA
GCCTGACCCTGACCTTGGAGAGCCCCCCTGGTAGTAGCCCCTCAGTGCAATGTAGGAGTC
CAAGGGGTAAAAACATACAGGGGGGGAAGACCCTCTCCGTGTCTCAGCTGGAGCTCCAGG
ATAGTGGCACCTGGACATGCACTGTCTTGCAGAACCAGAAGAAAGTGGAGTTCAAAATAG
ACATCGTGGTGCTAGCTNTCCAGAAGCCTNCAGCATAGTCTATAAGAAAGAAGGGGACAG
GTGGAGTTCTCCTTCCACTCGCCTTTACCAGTGAAAGCTGACGGGCANTGGCGAACTGTG
GTGGCANGGCGGAAC
3' Read Nucleotide Sequence
>OriGene 3' read for NM_000616 unedited
CGCTTTTAAAGTGAGTTTTTTTTTTTTTTTTTTAATCTTTATAGAAAGTTTATTGTATTT
TTATTTCAGCTCAGGGGAGCAGGGGTGGAGAGTGGGCACAAATGCAAAGTAAGCAAATGG
GGAGCCCCAGCAGCAATAGGGGGGTCTTCCTGGAAGAGGCAGGCTTTAAAGACAGGAGGA
GAAGGAAATAGGGAAAAGGAGTTGGGACTGAGGGAAGTGGTGAGGAAGGGTAGGAAGAGA
GGGGATCCTGAGAGAAGTGGATCAAGAAGATTTGTAACCCTGATTTCCCTGTGTCCTGAA
TGGTCTGGAGGAGGGTAAGGGAGGGTGTGGGGCAGGCGCATAGCCTGGCACAATCACCTT
TGAGGTCCCTTAGAGGGTTCCCTCTCAGGCTAGCTACCCCCTCTCCCAGCAAAGCTCGCT
TCCAGGAGGTTCTGCACAGGGTCAGTGACTGGTCACTGGGCATTCTCTCCTGCAGTGCCT
GTGCTCCCAGCTTGCGCTCTGATTATAAGAGCCAAAGGCTTTGACCTCTGGTAACAGATT
CTGCCACCAGCGGGGGATGAAGGAGGGATTTTAGACAGGGAGGCCTTCATCCCTGCTCGA
AAATTCTCTGAGATGGACCCTTCCCATGGGTGCTGTGCTTCTGTGAACCCATAAGCACAC
ATTGAGTACCCCACCACTACCCACTGGTGAGAGCCGTGCGGCATTTGACCCTGCCTTCAA
GAAGCAATAGTGGAACTTGGGACAAGGACCTGGGTTACCTCCGACTCAACACCTTGCTAT
ACGGCCCTCGCGCATAATCTTTTACCTCTCTAGCCTCTGCTCCGCATTTTTCCCGCGCAG
TCTCCCCTCCCTCCTTGCCCTCCCTTTTCTCACCCACCTTCTATTTTCCTCCTCCCCTCT
CGTCTCCCTCGACCTTTTCCTTCTCTCTCCCATCTTCTCCCTCCTCCCCCCCTCCCCCCT
CCCCCTCGTCTCTCCCTTCCAT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_000616
ORF Size 1377 bp
Insert Size 3070
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_000616.2, NP_000607
RefSeq Size 3084
Locus ID 920
Cytogenetics 12p13.31
Domains ig, IGv, IGc2, IG
Protein Families ES Cell Differentiation/IPS, Transmembrane, Adult stem cells, Induced pluripotent stem cells, Druggable Genome
Protein Pathways Cell adhesion molecules (CAMs), Antigen processing and presentation, Hematopoietic cell lineage, T cell receptor signaling pathway, Primary immunodeficiency
Gene Summary This gene encodes a membrane glycoprotein of T lymphocytes that interacts with major histocompatibility complex class II antigenes and is also a receptor for the human immunodeficiency virus. This gene is expressed not only in T lymphocytes, but also in B cells, macrophages, and granulocytes. It is also expressed in specific regions of the brain. The protein functions to initiate or augment the early phase of T-cell activation, and may function as an important mediator of indirect neuronal damage in infectious and immune-mediated diseases of the central nervous system. Multiple alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Aug 2010].
Transcript Variant: This variant (1) encodes the longest isoform (1) including a signal peptide and a mature peptide.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations