Orexin Receptor 2 (HCRTR2) (NM_001526) Human Untagged Clone

SKU
SC119187
HCRTR2 (untagged)-Human hypocretin (orexin) receptor 2 (HCRTR2)
$686.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Orexin Receptor 2
Synonyms ORXR2; OX2R; OXR2
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_001526 edited
ATGTCCGGCACCAAATTGGAGGACTCCCCCCCTTGTCGCAACTGGTCATCTGCTTCGGAG
CTGAATGAAACTCAAGAGCCCTTTTTAAACCCCACCGACTATGACGACGAGGAATTCCTG
CGGTACCTGTGGAGGGAATACCTGCACCCGAAAGAATATGAGTGGGTCCTGATCGCCGGG
TACATCATCGTGTTCGTCGTGGCTCTCATTGGGAACGTCCTGGTTTGTGTGGCAGTGTGG
AAGAACCACCACATGAGGACGGTAACCAACTACTTCATAGTCAATCTTTCTCTGGCTGAT
GTGCTCGTGACCATCACCTGCCTTCCAGCCACACTGGTCGTGGATATCACTGAGACCTGG
TTTTTTGGACAGTCCCTTTGCAAAGTGATTCCTTATCTACAGACCGTGTCGGTGTCTGTG
TCTGTCCTCACACTGAGCTGTATCGCCTTGGATCGGTGGTATGCAATCTGTCACCCTTTG
ATGTTTAAGAGCACAGCAAAGCGGGCCCGTAACAGCATTGTCATCATCTGGATTGTCTCC
TGCATTATAATGATTCCTCAGGCCATCGTCATGGAGTGCAGCACCGTGTTCCCAGGCTTA
GCCAATAAAACCACCCTCTTTACGGTGTGTGATGAGCGCTGGGGTGGTGAAATTTATCCC
AAGATGTACCACATCTGTTTCTTTCTGGTGACATACATGGCACCACTGTGTCTCATGGTG
TTGGCTTATCTGCAAATATTTCGCAAACTCTGGTGTCGACAGATCCCTGGAACATCATCT
GTAGTTCAGAGAAAATGGAAGCCCCTGCAGCCTGTTTCACAGCCTCGAGGGCCAGGACAG
CCAACGAAGTCCCGGATGAGCGCTGTGGCGGCTGAAATAAAGCAGATCCGAGCCAGAAGG
AAAACAGCCCGGATGTTGATGATTGTGCTTTTGGTATTTGCAATTTGCTATCTACCAATT
AGCATCCTCAATGTGCTAAAGAGAGTATTTGGGATGTTTGCCCATACTGAAGACAGAGAG
ACTGTGTATGCCTGGTTTACCTTTTCACACTGGCTTGTATATGCCAATAGTGCCGCGAAT
CCAATTATTTATAATTTTCTCAGTGGAAAATTTCGAGAGGAATTTAAAGCTGCGTTTTCT
TGCTGTTGCCTTGGAGTTCACCATCGCCAGGAGGATCGGCTCACCAGGGGACGAACTAGC
ACAGAGAGCCGGAAGTCCTTGACCACTCAAATCAGCAACTTTGATAACATATCAAAACTT
TCTGAGCAAGCTGTGCTCACTAGCATAAGCACACTCCCAGCAGCCAATGGAGCAGGACCA
CTTCAAAACTGGTAG
Restriction Sites Please inquire
ACCN NM_001526
Insert Size 1400 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to the protein associated with this reference, NM_001526.2.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001526.2, NP_001517.1
RefSeq Size 1843 bp
RefSeq ORF 1335 bp
Locus ID 3062
UniProt ID O43614
Cytogenetics 6p12.1
Protein Families Druggable Genome
Protein Pathways Neuroactive ligand-receptor interaction
Summary The protein encoded by this gene is a G-protein coupled receptor involved in the regulation of feeding behavior. The encoded protein binds the hypothalamic neuropeptides orexin A and orexin B. A related gene (HCRTR1) encodes a G-protein coupled receptor that selectively binds orexin A. [provided by RefSeq, Jan 2009]
Write Your Own Review
You're reviewing:Orexin Receptor 2 (HCRTR2) (NM_001526) Human Untagged Clone
Your Rating
SKU Description Size Price
RC213760 HCRTR2 (Myc-DDK-tagged)-Human hypocretin (orexin) receptor 2 (HCRTR2) 10 ug
$686.00
RC213760L1 Lenti ORF clone of Human hypocretin (orexin) receptor 2 (HCRTR2), Myc-DDK-tagged 10 ug
$986.00
RC213760L2 Lenti ORF clone of Human hypocretin (orexin) receptor 2 (HCRTR2), mGFP tagged 10 ug
$986.00
RC213760L3 Lenti ORF clone of Human hypocretin (orexin) receptor 2 (HCRTR2), Myc-DDK-tagged 10 ug
$986.00
RC213760L4 Lenti ORF clone of Human hypocretin (orexin) receptor 2 (HCRTR2), mGFP tagged 10 ug
$986.00
RG213760 HCRTR2 (tGFP-tagged) - Human hypocretin (orexin) receptor 2 (HCRTR2) 10 ug
$886.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.