Caveolin 1(CAV1) (NM_001753) Human Untagged Clone

CAT#: SC119082

CAV1 (untagged)-Human caveolin 1, caveolae protein, 22kDa (CAV1), transcript variant 1

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Caveolin 1(CAV1) (NM_001753) Human Untagged Clone
Symbol CAV1
Synonyms BSCL3; CGL3; LCCNS; MSTP085; PPH3; VIP21
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_001172895 edited
GAATTCGGCACGAGGCTCCTCACAGTTTTCATCCAGCCACGGGCCAGCATGTCTGGGGGC
AAATACGTAGACTCGGAGGGACATCTCTACACCGTTCCCATCCGGGAACAGGGCAACATC
TACAAGCCCAACAACAAGGCCATGGCAGACGAGCTGAGCGAGAAGCAAGTGTACGACGCG
CACACCAAGGAGATCGACCTGGTCAACCGCGACCCTAAACACCTCAACGATGACGTGGTC
AAGATTGACTTTGAAGATGTGATTGCAGAACCAGAAGGGACACACAGTTTTGACGGCATT
TGGAAGGCCAGCTTCACCACCTTCACTGTGACGAAATACTGGTTTTACCGCTTGCTGTCT
GCCCTCTTTGGCATCCCGATGGCACTCATCTGGGGCATTTACTTCGCCATTCTCTCTTTC
CTGCACATCTGGGCAGTTGTACCATGCATTAAGAGCTTCCTGATTGAGATTCAGTGCATC
AGCCGTGTCTATTCCATCTACGTCCACACCGTCTGTGACCCACTCTTTGAAGCTGTTGGG
AAAATATTCAGCAATGTCCGCATCAACTTGCAGAAAGAAATATAAATGACATTTCAAGGA
TAGAAGTATACCTGATTTTTTTTCCTTTTAATTTTCCTGTCAAGTTCCAAGTTGCTAATA
CAGCAACAATTTATGAATTGAATTATCTTGGTTGAAAATAAAAAGATCACTTTCTCAGTT
TTCATAAGTATTATGTCTCTTCTGAGCTATTTCATCTATTTTTGGCAGTCTGAATTTTTA
AAACCCATTTAAATTTTTTTCCTTACCTTTTTATTTGCATGTGGATCAACCATCGCTTTA
TTGGCTGAGATATGAACATATTGTTGAAAGGTAATTTGAGAGAAATATGAAGAACTGAGG
AGGAAAAAAAAAAAAAAGAAAAGAACCAACAACCTCAACTGCCTACTCCAAAATGTTGGT
CATTTTATGTTAAGGGAAGAATTCCAGGGTATGGCCATGGAGTGTACAAGTATGTGGGCA
GATTTTCAGCAAACTCTTTTCCCACTGTTTAAGGAGTTAGTGGATTACTGCCATTCACTT
CATAATCCAGTAGGATCCAGTGATCCTTACAAGTTAGAAAACATAATCTTCTGCCTTCTC
ATGATCCAACTAATGCCTTACTCTTCTTGAAATTTTAACCTATGATATTTTCTGTGCCTG
AATATTTGTTATGTAGATAACAAGACCTCAGTGCCTTCCTGTTTTTCACATTTTCCTTTT
CAAATAGGGTCTAACTCAGCAACTCGCTTTAGGTCAGCAGCCTCCCTGAAGACCAAAATT
AGAATATCCATGACCTAGTTTTCCATGCGTGTTTCTGACTCTGAGCTACAGAGTCTGGTG
AAGCTCACTTCTGGGCTTCATCTGGCAACATCTTTATCCGTAGTGGGTATGGTTGACACT
AGCCCAATGAAATGAATTAAAGTGGACCAATAGGGCTGAGCTCTCTGTGGGCTGGCAGTC
CTGGAAGCCAGCTTTCCCTGCCTCTCATCAACTGAATGAGGTCAGCATGTCTATTCAGCT
TCGTTTATTTTCAAGAATAATCACGCTTTCCTGAATCCAAACTAATCCATCACCGGGGTG
GTTTAGTGGCTCAACATTGTGTTCCCATTTCAGCTGATCAGTGGGCCTCCAAGGAGGGGC
TGTAAAATGGAGGCCATTGTGTGAGCCTATCAGAGTTGCTGCAAACCTGACCCCTGCTCA
GTAAAGCACTTAAAAGATTGAAGTATTTTGCTGGAATAAGTTCAAATTCTTCTGAACTCA
AACTGAGGAATTTCACCTGTAAACCTGAGTCGTACAGAAAGCTGCCTGGTATATCCAAAA
GCTTTTTATTCCTCCTGCTCATATTGTGATTCTGCCTTTGGGGACTTTTCTTAAACCTTC
AGTTATGATTTTTTTTTCATACACTTATTGGAACTCTGCTTGATTTTTGCCTCTTCCAGT
CTTCCTGACACTTTAATTACCAACCTGTTACCTACTTTGACTTTTTGCATTTAAAACAGA
CACTGGCATGGATATAGTTTTACTTTTAAACTGTGTACATAACTGAAAATGTGCTATACT
GCATACTTTTTAAATGTAAAGATATTTTTATCTTTATATGAAGAAAATCACTTAGGAAAT
GGCTTTGTGATTCAATCTGTAAACTGTGTATTCCAAGACATGTCTGTTCTACATAGATGC
TTAGTCCCTCATGCAAATCAATTACTGGTCCAAAAGATTGCTGAAATTTTATATGCTTAC
TGATATATTTTACAATTTTTTATCATGCATGTCCTGTAAAGGTTACAAGCCTGCACAATA
AAAATGTTTAACGGTTAAAAAAAAAAAAAAAAAACTCGAC
5' Read Nucleotide Sequence
>OriGene 5' read for NM_001753 unedited
TTGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGCTCCTCACAGTTTTC
ATCCAGCCACGGGCCAGCATGTCTGGGGGCAAATACGTAGACTCGGAGGGACATCTCTAC
ACCGTTCCCATCCGGGAACAGGGCAACATCTACAAGCCCAACAACAAGGCCATGGCAGAC
GAGCTGAGCGAGAAGCAAGTGTACGACGCGCACACCAAGGAGATCGACCTGGTCAACCGC
GACCCTAAACACCTCAACGATGACGTGGTCAAGATTGACTTTGAAGATGTGATTGCAGAA
CCAGAAGGGACACACAGTTTTGACGGCATTTGGAAGGCCAGCTTCACCACCTTCACTGTG
ACGAAATACTGGTTTTACCGCTTGCTGTCTGCCCTCTTTGGCATCCCGATGGCACTCATC
TGGGGCATTTACTTCGCCATTCTCTCTTTCCTGCACATCTGGGCAGTTGTACCATGCATT
AAGAGCTTCCTGATTGAGATTCAGTGCATCAGCCGTGTCTATTCCATCTACGTCCACACC
GTTTGTGACCCACTCTTTGAAGCTGTTGGGAAAATATTCAGCAATGTCCGCATCACCTTG
CAGAAAGAAATATAAATGACATTTTCAGGATAGAAGTATACCTGATTTTTTTTTCCTTTT
AATCTTCCTGTCAAGTTCCAAGTTGCTAATACAGCAACAATTTATGAATTGAATTACCTC
GGTTGAAAAAAAAAGATCACTTTCTCAGTTTTCATAAGAATTATGCTCTTCTGAGCTATT
TCATCTATTTTGGGCAGCCTGAATTTTAAAACCCCATTAAATTTTTTCCCTTCCCTTTTT
ATTTGAAGGGGGAACAACCATCCCTTTATTGGCTGGAGAAATCAACTACTGTGTGGAGAG
TTATTTGGGCAAAATTTTGACAAACTGGGGAGGAAAAAAAAACAAGAAATGCAC
3' Read Nucleotide Sequence
>OriGene 3' read for NM_001753 unedited
ACCGCGGGCCGCAATCTAGAGTCGAGTTTTTTTTTTTTTTTTTTAACCGTTAAACATTTT
TATTGTGCAGGCTTGTAACCTTTACAGGACATGCATGATAAAAAATTGTAAAATATATCA
GTAAGCATATAAAATTTCAGCAATCTTTTGGACCAGTAATTGATTTGCATGAGGGACTAA
GCATCTATGTAGAACAGACATGTCTTGGAATACACAGTTTACAGATTGAATCACAAAGCC
ATTTCCTAAGTGATTTTCTTCATATAAAGATAAAAATATCTTTACATTTAAAAAGTATGC
AGTATAGCACATTTTCAGTTATGTACACAGTTTAAAAGTAAAACTATATCCATGCCAGTG
TCTGTTTTAAATGCAAAAAGTCAAAGTAGGTAACAGGTTGGTAATTAAAGTGTCAGGAAG
ACTGGAAGAGGCAAAAATCAAGCAGAGTTCCAATAAGTGTATGAAAAAAAAATCATAACT
GAAGGTTTAAGAAAAGTCCCCAAAGGCAGAATCACAATATGAGCAGGAGGAATAAAAAGC
TTTTGGATATACCAGGCAGCTTTCTGTACGACTCAGGTTTACAGGTGAAATTCCTCAGTT
TGAGTTCAGAAGAATTTGAACTTATTCCAGCAAAATACTTCAATCTTTTAAGTGCTNTAC
TGAGCANGGGTCANGGTTGCAGCAACTCTGATAGGCTCACACAATGGCCTNCATTTTACA
GCCCCTCCTTGGNAGGCCACTGATCAGCTGAAATGGGAAACACATGNTGAGCCACTAAAC
CACCCCGGTGATGGGATAGTTTGGATCAGGAAAGCGTGATTATTCTGAAAATAACGAGCT
GAATAGACTGCTGACCTCATCANTGATGAGAGCAGGNAAAGCTGCTTNCAGATGNCAGCC
ACAGAGAGCTAGCCTATGGNNCCTTNNATCATTCATGGGCTANGTCACCTCACACTACGA
TAAGATGTGCGATGAGCCAAAGTGGACTACCAACTTTGTGCTAAGTCGAAACAGCTGAAA
CTAGC
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_001753
ORF Size 537 bp
Insert Size 2400
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation A TrueClone.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001753.3, NP_001744
RefSeq Size 2704
RefSeq ORF 537
Locus ID 857
Cytogenetics 7q31.2
Domains Caveolin
Protein Families Transmembrane, Druggable Genome
Protein Pathways Focal adhesion, Viral myocarditis
Gene Summary The scaffolding protein encoded by this gene is the main component of the caveolae plasma membranes found in most cell types. The protein links integrin subunits to the tyrosine kinase FYN, an initiating step in coupling integrins to the Ras-ERK pathway and promoting cell cycle progression. The gene is a tumor suppressor gene candidate and a negative regulator of the Ras-p42/44 mitogen-activated kinase cascade. Caveolin 1 and caveolin 2 are located next to each other on chromosome 7 and express colocalizing proteins that form a stable hetero-oligomeric complex. Mutations in this gene have been associated with Berardinelli-Seip congenital lipodystrophy. Alternatively spliced transcripts encode alpha and beta isoforms of caveolin 1.[provided by RefSeq, Mar 2010]
Transcript Variant: This variant (1) encodes the longer isoform (alpha).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations