CD26 (DPP4) (NM_001935) Human Untagged Clone

USD 300.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name CD26 (DPP4) (NM_001935) Human Untagged Clone
Type Human Untagged Clone
Tag Tag Free
Symbol DPP4
Synonyms ADABP; ADCP2; CD26; DPPIV; TP103
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Cell Selection None
Sequence Data
>OriGene sequence for NM_001935 edited
GAATTCGGCACGAGGGCGAGTGACTCCACCGCCCGGAGCAGCGGTGCAGGACGCGCGTCT
CCGCCGCCCGCGGTGACTTCTGCCTGCGCTCCTTCTCTGAACGCTCACTTCCGAGGAGAC
GCCGACGATGAAGACACCGTGGAAGGTTCTTCTGGGACTGCTGGGTGCTGCTGCGCTTGT
CACCATCATCACCGTGCCCGTGGTTCTGCTGAACAAAGGCACAGATGATGCTACAGCTGA
CAGTCGCAAAACTTACACTCTAACTGATTACTTAAAAAATACTTATAGACTGAAGTTATA
CTCCTTAAGATGGATTTCAGATCATGAATATCTCTACAAACAAGAAAATAATATCTTGGT
ATTCAATGCTGAATATGGAAACAGCTCAGTTTTCTTGGAGAACAGTACATTTGATGAGTT
TGGACATTCTATCAATGATTATTCAATATCTCCTGATGGGCAGTTTATTCTCTTAGAATA
CAACTACGTGAAGCAATGGAGGCATTCCTACACAGCTTCATATGACATTTATGATTTAAA
TAAAAGGCAGCTGATTACAGAAGAGAGGATTCCAAACAACACACAGTGGGTCACATGGTC
ACCAGTGGGTCATAAATTGGCATATGTTTGGAACAATGACATTTATGTTAAAATTGAACC
AAATTTACCAAGTTACAGAATCACATGGACGGGGAAAGAAGATATAATATATAATGGAAT
AACTGACTGGGTTTATGAAGAGGAAGTCTTCAGTGCCTACTCTGCTCTGTGGTGGTCTCC
AAACGGCACTTTTTTAGCATATGCCCAATTTAACGACACAGAAGTCCCACTTATTGAATA
CTCCTTCTACTCTGATGAGTCACTGCAGTACCCAAAGACTGTACGGGTTCCATATCCAAA
GGCAGGAGCTGTGAATCCAACTGTAAAGTTCTTTGTTGTAAATACAGACTCTCTCAGCTC
AGTCACCAATGCAACTTCCATACAAATCACTGCTCCTGCTTCTATGTTGATAGGGGATCA
CTACTTGTGTGATGTGACATGGGCAACACAAGAAAGAATTTCTTTGCAGTGGCTCAGGAG
GATTCAGAACTATTCGGTCATGGATATTTGTGACTATGATGAATCCAGTGGAAGATGGAA
CTGCTTAGTGGCACGGCAACACATTGAAATGAGTACTACTGGCTGGGTTGGAAGATTTAG
GCCTTCAGAACCTCATTTTACCCTTGATGGTAATAGCTTCTACAAGATCATCAGCAATGA
AGAAGGTTACAGACACATTTGCTATTTCCAAATAGATAAAAAAGACTGCACATTTATTAC
AAAAGGCACCTGGGAAGTCATCGGGATAGAAGCTCTAACCAGTGATTATCTATACTACAT
TAGTAATGAATATAAAGGAATGCCAGGAGGAAGGAATCTTTATAAAATCCAACTTAGTGA
CTATACAAAAGTGACATGCCTCAGTTGTGAGCTGAATCCGGAAAGGTGTCAGTACTATTC
TGTGTCATTCAGTAAAGAGGCGAAGTATTATCAGCTGAGATGTTCCGGTCCTGGTCTGCC
CCTCTATACTCTACACAGCAGCGTGAATGATAAAGGGCTGAGAGTCCTGGAAGACAATTC
AGCTTTGGATAAAATGCTGCAGAATGTCCAGATGCCCTCCAAAAAACTGGACTTCATTAT
TTTGAATGAAACAAAATTTTGGTATCAGATGATCTTGCCTCCTCATTTTGATAAATCCAA
GAAATATCCTCTACTATTAGATGTGTATGCAGGCCCATGTAGTCAAAAAGCAGACACTGT
CTTCAGACTGAACTGGGCCACTTACCTTGCAAGCACAGAAAACATTATAGTAGCTAGCTT
TGATGGCAGAGGAAGTGGTTACCAAGGAGATAAGATCATGCATGCAATCAACAGAAGACT
GGGAACATTTGAAGTTGAAGATCAAATTGAAGCAGCCAGACAATTTTCAAAAATGGGATT
TGTGGACAACAAACGAATTGCAATTTGGGGCTGGTCATATGGAGGGTACGTAACCTCAAT
GGTCCTGGGATCGGGAAGTGGCGTGTTCAAGTGTGGAATAGCCGTGGCGCCTGTATCCCG
GTGGGAGTACTATGACTCAGTGTACACAGAACGTTACATGGGTCTCCCAACTCCAGAAGA
CAACCTTGACCATTACAGAAATTCAACAGTCATGAGCAGAGCTGAAAATTTTAAACAAGT
TGAGTACCTCCTTATTCATGGAACAGCAGATGATAACGTTCACTTTCAGCAGTCAGCTCA
GATCTCCAAAGCCCTGGTCGATGTTGGAGTGGATTTCCAGGCAATGTGGTATACTGATGA
AGACCATGGAATAGCTAGCAGCACAGCACACCAACATATATATACCCACATGAGCCACTT
CATAAAACAATGTTTCTCTTTACCTTAGCACCTCAAAATACCATGCCATTTAAAGCTTAT
TAAAACTCATTTTTGTTTTCATTATCTCAAAACTGCACTGTCAAGATGATGATGATCTTT
AAAATACACACTCAAATCAAGAAACTTAAGGTTACCTTTGTTCCCAAATTTCATACCTAT
CATCTTAAGTAGGGACTTCTGTCTTCACAACAGATTATTACCTTACAGAAGTTTGAATTA
TCCGGTCGGGTTTTATTGTTTAAAATCATTTCTGCATCAGCTGCTGAAACAACAAATAGG
AATTGTTTTTATGGAGGCTTTGCATAGATTCCCTGAGCAGGATTTTAATCXXXXXXXXXX
XXXXXXXXXXXXXXXGGTGGGGCAGTGATGTCACTTAGGGCAGGGACAGGATAAGAGGGA
TTAGGGAGAGAAGATAGCAGGGCATGGCTGGGAACCCAAGTCCAAGCATACCAACACGAG
CAGGCTACTGTCAGCTCCCCTCGGAGAAGAGCTGTTCACAGCCAGACTGGCACAGTTTTC
TGAGAAAGACTATTCAAACAGTCTCAGGAAATCAAATATGCAAAGCACTGACTTCTAAGT
AAAACCACAGCAGTTGAAAAGACTCCAAAGAAATGTAAGGGAAACTGCCAGCAACGCAGG
CCCCCAGGTGCCAGTTATGGCTATAGGTGCTACAAAAACACAGCAAGGGTGATGGGAAAG
CATTGTAAATGTGCTTTTAAAAAAAAATACTGATGTTCCTAGTGAAAGAGGCAGCTTGAA
ACTGAGATGTGAACACATCAGCTTGCCCTGTTAAAAGATGAAAATATTTGTATCACAAAT
CTTAACTTGAAGGAGTCCTTGCATCAATTTTTCTTATTTCATTTCTTTGAGTGTCTTAAT
TAAAAGAATATTTTAACTTCCTTGGACTCATTTTAAAAAATGGAACATAAAATACAATGT
TATGTATTATTATTCCCATTCTACATACTATGGAATTTCTCCCAGTCATTTAATAAATGT
GCCTTCATTTTTTCAGAAGAAAAAAAAAAAAAAAAAAACTCGAC
>OriGene 5' read for NM_001935 unedited
GGGTGTCGGATTTTGTATACGACTCCTATGGGCGGCCCGCGATTCGGCACGAGGGCGAGT
GACTCCACCGCCCGGNGCAGCGGTGCAGGACGCGCGTCTCCGCCGCCCGCGGTGACTTCT
GCCTGCGCTCCTTCTCTGAACGCTCACTTCCGAGGAGACGCCGACGATGAAGACACCGTG
GAAGGTTCTTCTGGGACTGCTGGGTGCTGCTGCGCTTGTCACCATCATCACCGTGCCCGT
GGTTCTGCTGAACAAAGGCACAGATGATGCTACAGCTGACAGTCGCAAAACTTACACTCT
AACTGATTACTTAAAAAATACTTATAGACTGAAGTTATACTCCTTAAGATGGATTTCAGA
TCATGAATATCTCTACAAACAAGAAAATAATATCTTGGTATTCAATGCTGAATATGGAAA
CAGCTCAGTTTTCTTGGAGAACAGTACATTTGATGAGTTTGGACATTCTATCAATGATTA
TTCAATATCTCCTGATGGGCAGTTTATTCTCTTAGAATACAACTACGTGAAGCAATGGAG
GCATTCCTACACAGCTTCATATGACATTTATGATTTAAATAAAAGGCAGCTGATTACAGA
AGAGAGGATTCCAAACAACACACAGTGGGTCACATGGTCACCAGTGGGTCATAAATTGGC
ATATGTTTGGAACAATGACATTTATGTTAAAATTGAACCAAATTTACCAAGTTACAGAAT
CACATGGACGGNGAAAGAAGATATAATATATAATGGAATAACTGACTGGGTTTATGAANA
GGGAAGTCTCAGTGCCTACTCTGCTCTGTGGGTGGTCTCCAACGGCACTNTNTTAGCATA
TGCCCCATTTAACGACACAGAAAGTCCCACTTATTGATACTNCTTCTACTCTGATGAGTC
ACTGCAGTACCAAGACTGTGTACGGG
>OriGene 3' read for NM_001935 unedited
GAACCGCGGGCCGCAATTTACAGTCGAGTTTTTTTTTTTTTTTTTTTCTTCTGAAAAATG
ATGGCACATTTATTAAATGACTGGGAGAAATTCCATAGTATGTAGAATGGGAATAATAAT
ACATAACATTGTATTTTATGTTCCATTTTTTAAAATGAGTCCAAGGAAGTTAAAATATTC
TTTTAATTAAGACACTCAAAGAAATGAAATAAGAAAATTTGATGCAAGGACTCCTTCAAG
TTAAGATTTGTGATACAATTTTTTTCATCTTTTAACAGGGCAAGCTGATGTGTTCACATC
TCAGTTTCAAGCTGCCTCTTTCACTAGGAACATCAGTATTTTTTTTTAAAAGCACATTTA
CAATGCTTTCCCATCACCCTTGCTGTGTTTTTGTAGCACCTATAGCCATAACTGGCACCT
GGGGGCCTGCGTTGCTGGCAGTTTCCCTTACATTTCTTTGGAGTCTTTTCACCTGCTGTG
GTTTTACTTACAAGTCAGTGCTTTGCATATTTGATTTCCTGAGACTGTTTGAATAGTCTT
TCTCAGAAAACTGTGCCAGTCTGGCTGTGAAACAGCTCTTCTCCGAGGGGAGCTGACAGC
CCCCTGCTCGTGTTGGTATGCCTGGACCTGGGTTACCAGACATGGCCTGCTATTTTCTTT
CCTAATCCCTCCTACCCTGGCCCTGCCCTCATGACCCCCCTGCTCCCCCCCTTCCCCCCC
TTCCAAAGAACACACCCCCTTCTGACCCCCTTCACCCTACCCCCCCCTACACCTCCTCCT
TCGTAACTATATCCCTACCCTCCCTCCCCCCATCCTCCCTTCGCCCCCATCACTCCAGCC
TCCCGCCCTTATCCCATTCCCCCTCCTGTTCTCCCCCCCCCCCCCAGCCCCCACCTCCCC
TCGACACCTTATTCTCACCAATACCTCCCCCCCACTTCGTCCACCCGTCTTGCTTATATT
CATCCTCCCCCTTCTCTCCCCCTCCTTATTTTACCCCCCCCCCCTCC
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_001935
ORF Size 2301 bp
Insert Size 3700
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001935.3, NP_001926.2
RefSeq Size 3913
RefSeq ORF 2301
Locus ID 1803
Cytogenetics 2q24.2
Domains Peptidase_S9, DPPIV_N_term
Protein Families Druggable Genome, Protease, Secreted Protein, Transmembrane
Gene Summary The protein encoded by this gene is identical to adenosine deaminase complexing protein-2, and to the T-cell activation antigen CD26. It is an intrinsic membrane glycoprotein and a serine exopeptidase that cleaves X-proline dipeptides from the N-terminus of polypeptides. [provided by RefSeq, Jul 2008]

Citations (1)

Other Versions

Other products for "DPP4"
Frequently bought together (2)
Anti-DPP4 (CD26) mouse monoclonal antibody, clone OTI11D7 (formerly 11D7)
    • 100 ul

USD 379.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones