FGF2 (NM_002006) Human Untagged Clone

CAT#: SC118884

FGF2 (untagged)-Human fibroblast growth factor 2 (basic) (FGF2)

USD 618.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name FGF2 (NM_002006) Human Untagged Clone
Symbol FGF2
Synonyms BFGF; FGF-2; FGFB; HBGF-2
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_002006 edited
GAATTCGGCACGAGGGGAGGGAGGAGAACTGGGGGCGCGGGAGGCTGGTGGGTGTGGGGG
GTGGAGATGTAGAAGATGTGACGCCGCGGCCCGGCGGGTGCCAGATTAGCGGACGCGGTG
CCCGCGGTTGCAACGGGATCCCGGGCGCTGCAGCTTGGGAGGCGGCTCTCCCCAGGCGGC
GTCCGCGGAGACACCCATCCGTGAACCCCAGGTCCCGGGCCGCCGGCTCGCCGCGCACCA
GGGGCCGGCGGACAGAAGAGCGGCCGAGCGGCTCGAGGCTGGGGGACCGCGGGCGCGGCC
GCGCGCTGCCGGGCGGGAGGCTGGGGGGCCGGGGCCGGGGCCGTGCCCCGGAGCGGGTCG
GAGGCCGGGGCCGGGGCCGGGGGACGGCGGCTCCCCGCGCGGCTCCAGCGGCTCGGGGAT
CCCGGCCGGGCCCCGCAGGGACCATGGCAGCCGGGAGCATCACCACGCTGCCCGCCTTGC
CCGAGGATGGCGGCAGCGGCGCCTTCCCGCCCGGCCACTTCAAGGACCCCAAGCGGCTGT
ACTGCAAAAACGGGGGCTTCTTCCTGCGCATCCACCCCGACGGCCGAGTTGACGGGGTCC
GGGAGAAGAGCGACCCTCACATCAAGCTACAACTTCAAGCAGAAGAGAGAGGAGTTGTGT
CTATCAAAGGAGTGTGTGCTAACCGTTACCTGGCTATGAAGGAAGATGGAAGATTACTGG
CTTCTAAATGTGTTACGGATGAGTGTTTCTTTTTTGAACGATTGGAATCTAATAACTACA
ATACTTACCGGTCAAGGAAATACACCAGTTGGTATGTGGCACTGAAACGAACTGGGCAGT
ATAAACTTGGATCCAAAACAGGACCTGGGCAGAAAGCTATACTTTTTCTTCCAATGTCTG
CTAAGAGCTGATTTTAATGGCCACATCTAATCTCATTTCACATGAAAGAAGAAGTATATT
TTAGAAATTTGTTAATGAGAGTAAAAGAAAATAAATGTGTATAGCTCAGTTTGGATAATT
GGTCAAACAATTTTTTATCCAGTAGTAAAATATGTAACCATTGTCCCAGTAAAGAAAAAT
AACAAAAGTTGTAAAATGTATATTCTCCCTTTTATATTGCATCTGCTGTTACCCAGTGAA
GCTTACCTAGAGCAATGATCTTTTTCACGCATTTGCTTTATTCGAAAAGAGGCTTTTAAA
ATGTGCATGTTTAGAAACAAAATTTCTTCATGGAAATCATATACATTAGAAAATCACAGT
CAGATGTTTAATCAATCCAAAATGTCCACTATTTCTTATGTCATTCGTTAGTCTACATGT
TTCTAAACATATAAATGTGAATTTAATCAATTCCTTTCATAGTTTTATAATTCTCTGGCA
GTTCCTTATGATAGAGTTTATAAAACAGTCCTGTGTAAACTGCTGGAAGTTCTTCCACAG
TCAGGTCAATTTTGTCAAACCCTTCTCTGTACCCATACAGCAGCAGCCTAGCAACTCTGC
TGGTGATGGGAGTTGTATTTTCAGTCTTCGCCAGGTCATTGAGATCCATCCACTCACATC
TTAAGCATTCTTCCTGGCAAAAATTTATGGTGAATGAATATGGCTTTAGGCGGCAGATGA
TATACATATCTGACTTCCCAAAAGCTCCAGGATTTGTGTGCTGTTGCCGAATACTCAGGA
CGGACCTGAATTCTGATTTTATACCAGTCTCTTCAAAAACTTCTCGAACCGCTGTGTCTC
CTACGTAAAAAAAGAGATGTACAAATCAATAATAATTACACTTTTAGAAACTGTATCATC
AAAGATTTTCAGTTAAAGTAGCATTATGTAAAGGCTCAAAACATTACCCTAACAAAGTAA
AGTTTTCAATACAAATTCTTTGCCTTGTGGATATCAAGAAATCCCAAAATATTTTCTTAC
CACTGTAAATTCAAGAAGCTTTTGAAATGCTGAATATTTCTTTGGCTGCTACTTGGAGGC
TTATCTACCTGTACATTTTTGGGGTCAGCTCTTTTTAACTTCTTGCTGCTCTTTTTCCCA
AAAGGTAAAAATATAGATTGAAAAGTTAAAACATTTTGCATGGCTGCAGTTCCTTTGTTT
CTTGAGATAAGATTCCAAAGAACTTAGATTCATTTCTTCAACACCGAAATGCTGGAGGTG
TTTGATCAGTTTTCAAGAAACTTGGAATATAAATAATTTTATAATTCAACAAAGGTTTTC
ACATTTTATAAGGTTGATTTTTCAATTAAATGCAAATTTATGTGGCAGGATTTTTATTGC
CATTAACATATTTTTGTGGCTGCTTTTTCTACACATCCAGATGGTCCCTCTAACTGGGCT
TTCTCTAATTTTGTGATGTTCTGTCATTGTCTCCCAAAGTATTTAGGAGAAGCCCTTTAA
AAAGCTGCCTTCCTCTACCACTTTGCTGGAAAGCTTCACAATTGTCACAGACAAAGATTT
TTGTTCCAATACTCGTTTTGCCTCTATTTTTCTTGTTTGTCAAATAGTAAATGATATTTG
CCCTTGCAGTAATTCTACTGGTGAAAAACATGCAAAGAAGAGGAAGTCACAGAAACATGT
CTCAATTCCCATGTGCTGTGACTGTAGACTGTCTTACCATAGACTGTCTTACCCATCCCC
TGGATATGCTCTTGTTTTTTCCCTCTAATAGCTATGGAAAGATGCATAGAAAGAGTATAA
TGTTTTAAAACATAAGGCATTCGTCTGCCATTTTTCAATTACATGCTGACTTCCCTTACA
ATTGAGATTTGCCCATAGGTTAAACATGGTTAGAAACAACTGAAAGCATAAAAGAAAAAT
CTAGGCCGGGTGCAGTGGCTCATGCCTATATTCCCTGCACTTTGGGAGGCCAAAGCAGGA
GGATCGCTTGAGCCCAGGAGTTCAAGACCAACCTGGTGAAACCCCGTCTCTACAAAAAAA
CACAAAAAATAGCCAGGCATGGTGGCGTGTACATGTGGTCTCAGATACTTGGGAGGCTGA
GGTGGGAGGGTTGATCACTTGAGGCTGAGAGGTCAAGGTTGCAGTGAGCCATAATCGTGC
CACTGCAGTCCAGCCTAGGCAACAGAGTGAGACTTTGTCTCAAAAAAAGAGAAATTTTCC
TTAATAAGAAAAGTAATTTTTACTCTGATGTGCAATACATTTGTTATTAAATTTATTATT
TAAGATGGTAGCACTAGTCTTAAATTGTATAAAATATCCCCTAACATGTTTAAATGTCCA
TTTTTATTCATTATGCTTTGAAAAATAATTATGGGGAAATACATGTTTGTTATTAAATTT
ATTATTAAAGATAGTAGCACTAGTCTTAAATTTGATATAACATCTCCTAACTTGTTTAAA
TGTCCATTTTTATTCTTTATGTTTGAAAATAAATTATGGGGATCCTATTTAGCTCTTAGT
ACCACTAATCAAAAGTTCGGCATGTAGCTCATGATCTATGCTGTTTCTATGTCGTGGAAG
CACCGGATGGGGGTAGTGAGCAAATCTGCCCTGCTCAGCAGTCACCATAGCAGCTGACTG
AAAATCAGCACTGCCTGAGTAGTTTTGATCAGTTTAACTTGAATCACTAACTGACTGAAA
ATTGAATGGGCAAATAAGTGCTTTTGTCTCCAGAGTATGCGGGAGACCCTTCCACCTCAA
GATGGATATTTCTTCCCCAAGGATTTCAAGATGAATTGAAATTTTTAATCAAGATAGTGT
GCTTTATTCTGTTGTATTTTTTATTATTTTAATATACTGTAAGCCAAACTGAAATAACAT
TTGCTGTTTTATAGGTTTGAAGAACATAGGAAAAACTAAGAGGTTTTGTTTTTATTTXXX
XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXGAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAACTCGAC
5' Read Nucleotide Sequence
>OriGene 5' read for NM_002006 unedited
ACATTTTGTATACGACTCACTTATAGGGCGGCCGCGAATTCGCACGAGGGGAGGGAGGAG
AACTGGGGGCGCGGGAGGCTGGTGGGTGTGGGGGGTGGAGATGTAGAAGATGTGACGCCG
CGGCCCGGCGGGTGCCAGATTAGCGGACGCGGTGCCCGCGGTTGCAACGGGATCCCGGGC
GCTGCAGCTTGGGAGGCGGCTCTCCCCAGGCGGCGTCCGCGGAGACACCCATCCGTGAAC
CCCAGGTCCCGGGCCGCCGGCTCGCCGCGCACCAGGGGCCGGCGGACAGAAGAGCGGCCG
AGCGGCTCGAGGCTGGGGGACCGCGGGCGCGGCCGCGCGCTGCCGGGCGGGAGGCTGGGG
GGCCGGGGCCGGGGCCGTGCCCCGGAGCGGGTCGGAGGCCGGGGCCGGGGCCGGGGGACG
GCGGCTCCCCGCGCGGCTCCAGCGGCTCGGGGATCCCGGCCGGGCCCCGCAGGGACCATG
GCAGCCGGGAGCATCACCACGCTGCCCGCCTTGCCCGAGGATGGCGGCAGCGGCGCCTTC
CCGCCCGGCCACTTCAAGGACCCCAAGCGGCTGTACTGCAAAAACGGNGGCTTCTTCCTG
CGCATCCACCCCGACGGCCGAGTTGACTGGGTCCGGGAGAAGAGCGACCCTCACATCAAG
CTACAACTTTAAGCAGAAGAGAGAGGAGTTGTGTCTATCAAATGAGTGTGTGCTAACCGT
TACCTGGCTATGAACGAAGAATGGAAGATTACTGGCTTCTAAAGTGTTACCGATGAGTGT
TTCTCTTTTCACCGATCGGAATCTATTACTACAATCTTTCCCGTCAAGGAATACACCATT
TGGTTTGTGGCACTGAACAAACTGCGCGCTTAACTCGGATCCAAAAGGAACTGGGCAGAA
AGCTTTCTTTTTCTTCCAAGTTGCTAAAACCTATTTAATGGCCCCCN
3' Read Nucleotide Sequence
>OriGene 3' read for NM_002006 unedited
TGTTGTTTTTCATCCTAATTCTATTATTAAATATAACAAAATAGAAATAACAAATATAAA
CTCCATTTCATTATTGTCCTGTAACTAAACAAAACAATACAACATATTTAAACATATCTC
TTCATCAGCAAAAATAAAAACAAAACCTCTTAGTTTTTCCTATGTTCTTCAAACCTATAA
AACAGCAAATGTTATTTCAGTTTGGCTTACAGTATATTAAAATAATAAAAAATACAACAG
AATAAAGCACACTATCTTGATTAAAAATTTCAATTCATCTTGAAATCCTTGGGGAAGAAA
TATCCATCTTGAGGTGGAAGGGTCTCCCGCATACTCTGGAGACAAAAGCACTTATTTGCC
CATTCAATTTTCAGTCAGTTAGTGATTCAAGTTAAACTGATCAAAACTACTCAGGCAGTG
CTGATTTTCAGTCAGCTGCTATGGTGACTGCTGAGCAGGGCAGATTTGCTCACTACCCCC
ATCCGGTGCTTCCACGACATAGAAACAGCATAGATCATGAGCTACATGCCGAACTTTTGA
TTAGTGGTACTAAGAGCTAAATAGGATCCCCATAATTTATTTTCAAACATAAAGAATAAA
AATGGACATTTAAACAAGTTAGGAGATGTTATATCAAATTTAAGACTAGTGCTACTATCT
CTAATAATAAATTTAATAACAAACATGTATCTCCCCATAATTATCTTTCACAGCATAATG
AATAAAAATGGACATTTAAACATGTTAGGGGATATTTTATACAATTTAAGACTAGTGCTA
CCATCTTAAATATAAATTTATAACACTGTATTGCACATCAGAGTAAAAATACTTTTCTAT
AAGGGAAATTTCTCTTTTTTGAGACAAGTCTACTCTGTGGCTAGCCTGACTGCAATGCAC
GATATTGCTCACTGCACTCTGACTCTCAGCCCCAGGATTACCCTTCCACTCACGCTCCAA
GGATTGNAACACATGCCCNCCACT
Tag Tag Free
ACCN NM_002006
ORF Size 867 bp
Insert Size 3570
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_002006.3, NP_001997
RefSeq Size 6803
Locus ID 2247
Cytogenetics 4q28.1
Domains FGF
Protein Families Secreted Protein, Druggable Genome
Protein Pathways MAPK signaling pathway, Regulation of actin cytoskeleton, Pathways in cancer, Melanoma
Gene Summary The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members bind heparin and possess broad mitogenic and angiogenic activities. This protein has been implicated in diverse biological processes, such as limb and nervous system development, wound healing, and tumor growth. The mRNA for this gene contains multiple polyadenylation sites, and is alternatively translated from non-AUG (CUG) and AUG initiation codons, resulting in five different isoforms with distinct properties. The CUG-initiated isoforms are localized in the nucleus and are responsible for the intracrine effect, whereas, the AUG-initiated form is mostly cytosolic and is responsible for the paracrine and autocrine effects of this FGF. [provided by RefSeq, Jul 2008].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations