GLP1R (NM_002062) Human Untagged Clone

CAT#: SC118878

GLP1R (untagged)-ORIGENE UNIQUE VARIANT 1 of Human glucagon-like peptide 1 receptor (GLP1R)

USD 721


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name GLP1R (NM_002062) Human Untagged Clone
Symbol GLP1R
Synonyms MGC138331
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_002062, the custom clone sequence may differ by one or more nucleotides


ATGGCCGGCGCCCCCGGCCCGCTGCGCCTTGCGCTGCTGCTGCTCGGGATGGTGGGCAGGGCCGGCCCCC
GCCCCCAGGGTGCCACTGTGTCCCTCTGGGAGACGGTGCAGAAATGGCGAGAATACCGACGCCAGTGCCA
GCGCTCCCTGACTGAGGATCCACCTCCTGCCACAGACTTGTTCTGCAACCGGACCTTCGATGAATACGCC
TGCTGGCCAGATGGGGAGCCAGGCTCGTTCGTGAATGTCAGCTGCCCCTGGTACCTGCCCTGGGCCAGCA
GTGTGCCGCAGGGCCACGTGTACCGGTTCTGCACAGCTGAAGGCCTCTGGCTGCAGAAGGACAACTCCAG
CCTGCCCTGGAGGGACTTGTCGGAGTGCGAGGAGTCCAAGCGAGGGGAAAGAAGCTCCCCGGAGGAGCAG
CTCCTGTTCCTCTACATCATCTACACGGTGGGCTACGCACTCTCCTTCTCTGCTCTGGTTATCGCCTCTG
CGATCCTCCTCGGCTTCAGACACCTGCACTGCACCAGGAACTACATCCACCTGAACCTGTTTGCATCCTT
CATCCTGCGAGCATTGTCCGTCTTCATCAAGGACGCAGCCCTGAAGTGGATGTATAGCACAGCCGCCCAG
CAGCACCAGTGGGATGGGCTCCTCTCCTACCAGGACTCTCTGAGCTGCCGCCTGGTGTTTCTGCTCATGC
AGTACTGTGTGGCGGCCAATTACTACTGGCTCTTGGTGGAGGGCGTGTACCTGTACACACTGCTGGCCTT
CTCGGTCTTATCTGAGCAATGGATCTTCAGGCTCTACGTGAGCATAGGCTGGGGTGTTCCCCTGCTGTTT
GTTGTCCCCTGGGGCATTGTCAAGTACCTCTATGAGGACGAGGGCTGCTGGACCAGGAACTCCAACATGA
ACTACTGGCTCATTATCCGGCTGCCCATTCTCTTTGCCATTGGGGTGAACTTCCTCATCTTTGTTCGGGT
CATCTGCATCGTGGTATCCAAACTGAAGGCCAATCTCATGTGCAAGACAGACATCAAATGCAGACTTGCC
AAGTCCACGCTGACACTCATCCCCCTGCTGGGGACTCATGAGGTCATCTTTGCCTTTGTGATGGACGAGC
ACGCCCGGGGGACCCTGCGCTTCATCAAGCTGTTTACAGAGCTCTCCTTCACCTCCTTCCAGGGGCTGAT
GGTGGCCATATTATACTGCTTTGTCAACAATGAGGTCCAGCTGGAATTTCGGAAGAGCTGGGAGCGCTGG
CGGCTTGAGCACTTGCACATCCAGAGGGACAGCAGCATGAAGCCCCTCAAGTGTCCCACCAGCAGCCTGA
GCAGTGGAGCCACGGCGGGCAGCAGCATGTACACAGCCACTTGCCAGGCCTCCTGCAGCTGA


5' Read Nucleotide Sequence
>OriGene 5' read for NM_002062 unedited
GAATACGACTCACTATAGGGCGGCCGCGAATTCGCCCTTGATGGCCCAGTCCTGAACTCC
CCGCCATGGCCGGCGCCCCCGGCCTGCTGCGCCTTGCGCTGCTGCTGCTCGGGATGGTGG
GCAGGGNCNGACCCCGCCCCCAGGGTGCCACTGTGTCCCTCTGGGAGACGGTGCAGAAAT
GGCGAGAATACCGACGCCAGTGCCAGCGCTCCCTGACTGAGGATCCACCTCCTGCCACAG
ACTTGTTCTGCAACCGGACCTTCGATGAATACGCCTGCTGGCCAGATGGGGAGCCAGGCT
CGTTCGTGAATGTCAGCTGCCCCTGGTACCTGCCCTGGGCCAGCAGTGTGCCGCAGGGCC
ACGTGTACCGGTTCTGCACAGCTGAAGGCCTCTGGCTGCAGAAGGACAACTCCAGCCTGC
CCTGGAGGGACTTGTCGGAGTGCGAGGAGTCCAAGCGAGGGGAGAGAAGCTCCCCGGAGG
AGCAGCTCCTGTTCCTCTACATCATCTACACGGTGGGCTACGCACTCTCCTTCTCTGCTC
TGGTTATCGCCTCTGCGATCCTCCTCGGCTTCAGA
3' Read Nucleotide Sequence
>OriGene 3' read for NM_002062 unedited
CATCCATAAGGCCCATTGGCGATGGTCAACTTGCCAGGNCCAGGAAAGCACTGGGGAAGG
GTCACAGGGCTGCCACCCGGGTTCTGTTCAGGAAACAGCTATGACCGCGGCCGCAATCTA
TAGTCGACAAGCTTGATATCGGTACCAGATCTGAATTCGCCCTTGAGTGTCTCTCCCACC
TGGATTGGCCACCCGGCCTGCAGCAAGGACCCCAGGGAGGGCAGGCGCTGGAGTCTCATC
TGCAAGAGGCCTGGCAAGTGGCTGTGTACATGCTGCTGCCCGCCGTGGCTCCACTGCTCA
AGCTGCTGGTGGGACACTTGAGGGGCTTCATGCTGCTGTCCCTCTGGATGTGCAAGTGCT
CAAGCCGCCAGCGCTCCCAGCTCTTCCGAAATTCCAGCTGGACCTCATTGTTGACAAAGC
AGTATAATATGGCCACCATCAGCCCCTGGAAAGAGGTGAAAGAGAGCTCTGTAAACAGCT
TGATGAAGCGCAGGGTCCCCCGGGCGTGCTCGTCCATCACAAAGGCAAAGATGACCTCGT
GAGTCCCCACAGGGGGATGGAGTGTCAGCGTGGACTTGGCAAGTCTGCATTTGATGTCTG
TCTTGCACATGAGATTGGCCTTCAGTTTGGATACCACGATGCATATGACCCGAACAAAGA
TGAGGGAAGTTCACCCCAATGGCAAAAGAGAATGGGCAGCCGGATAATGAGCCAGTAGTT
CATGGTTGGAAGTTCCCGGGTACAACAACCCCAACCTATGCTCACGTAGAGCCTGAAATT
CCTTTGCTTANATAAAACCCGANAAGCCCAGCGTGGTGTACAGGTACCCCCCCCCCCCCC
AGAGCCCGTTGTTTTTGGGCCCCCCCACATTCTGGTGGAGCAAAAAACCCAGG
Tag Tag Free
ACCN NM_002062
ORF Size 1392 bp
Insert Size 1650
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone was found to represent an alternative form of the specific reference to which it is associated. Its Open Reading Frame (ORF) may represent a novel form or alternative splice variant. By virtue of it being a true transcript (cDNA clone not PCR product), it provides a biologically relevant copy of its mRNA template. For more details, please evaluate the sequence information provided on this website or contact our customer care specialists.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_002062.2, NP_002053
RefSeq Size 3071
RefSeq ORF 1392
Locus ID 2740
Cytogenetics 6p21.2
Protein Families GPCR, ES Cell Differentiation/IPS, Transmembrane, Druggable Genome
Protein Pathways Neuroactive ligand-receptor interaction
Gene Summary This is a receptor for glucagon-like peptide 1. The activity of this receptor is mediated by G proteins which activate adenylyl cyclase. [UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations