GATA1 (NM_002049) Human Untagged Clone

SKU
SC118871
GATA1 (untagged)- Human GATA binding protein 1 (globin transcription factor 1), 10ug
$457.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol GATA1
Synonyms ERYF1; GATA-1; GF-1; GF1; NF-E1; NFE1; XLANP; XLTDA; XLTT
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_002049 edited
ATGGAGTTCCCTGGCCTGGGGTCCCTGGGGACCTCAGAGCCCCTCCCCCAGTTTGTGGAT
CCTGCTCTGGTGTCCTCCACACCAGAATCAGGGGTTTTCTTCCCCTCTGGGCCTGAGGGC
TTGGATGCAGCAGCTTCCTCCACTGCCCCGAGCACAGCCACCGCTGCAGCTGCGGCACTG
GCCTACTACAGGGACGCTGAGGCCTACAGACACTCCCCAGTCTTTCAGGTGTACCCATTG
CTCAACTGTATGGAGGGGATCCCAGGGGGCTCACCATATGCCGGCTGGGCCTACGGCAAG
ACGGGGCTCTACCCTGCCTCAACTGTGTGTCCCACCCGCGAGGACTCTCCTCCCCAGGCC
GTGGAAGATCTGGATGGAAAAGGCAGCACCAGCTTCCTGGAGACTTTGAAGACAGAGCGG
CTGAGCCCAGACCTCCTGACCCTGGGACCTGCACTGCCTTCATCACTCCCTGTCCCCAAT
AGTGCTTATGGGGGCCCTGACTTTTCCAGTACCTTCTTTTCTCCCACCGGGAGCCCCCTC
AATTCAGCAGCCTATTCCTCTCCCAAGCTTCGTGGAACTCTCCCCCTGCCTCCCTGTGAG
GCCAGGGAGTGTGTGAACTGCGGAGCAACAGCCACTCCACTGTGGCGGAGGGACAGGACA
GGCCACTACCTATGCAACGCCTGCGGCCTCTATCACAAGATGAATGGGCAGAACAGGCCC
CTCATCCGGCCCAAGAAGCGCCTGATTGTCAGTAAACGGGCAGGTACTCAGTGCACCAAC
TGCCAGACGACCACCACGACACTGTGGCGGAGAAATGCCAGTGGGGATCCCGTGTGCAAT
GCCTGCGGCCTCTACTACAAGCTACACCAGGTGAACCGGCCACTGACCATGCGGAAGGAT
GGTATTCAGACTCGAAACCGCAAGGCATCTGGAAAAGGGAAAAAGAAACGGGGCTCCAGT
CTGGGAGGCACAGGAGCAGCCGAAGGACCAGCTGGTGGCTTTATGGTGGTGGCTGGGGGC
AGCGGTAGCGGGAATTGTGGGGAGGTGGCTTCAGGCCTGACACTGGGCCCCCCAGGTACT
GCCCATCTCTACCAAGGCCTGGGCCCTGTGGTGCTGTCAGGGCCTGTTAGCCACCTCATG
CCTTTCCCTGGACCCCTACTGGGCTCACCCACGGGCTCCTTCCCCACAGGCCCCATGCCC
CCCACCACCAGCACTACTGTGGTGGCTCCGCTCAGCTCATGA
Restriction Sites Please inquire
ACCN NM_002049
Insert Size 1700 bp
OTI Disclaimer The sequence of an 'OriGene Unique Variant' differs significantly from the associated reference. It represents a novel splice variant from the same gene locus of the reference. Although such variants are true transcripts and present opportunity for discoveries, they are not yet curated by NCBI and should not be used if the exact reference accession sequence is required.
OTI Annotation The ORF of this clone has been fully sequenced and found to contain 15bp insertion compared with NM_002049.2.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_002049.2, NP_002040.1
RefSeq Size 1522 bp
RefSeq ORF 1242 bp
Locus ID 2623
UniProt ID P15976
Cytogenetics Xp11.23
Domains GATA
Protein Families Adult stem cells, Druggable Genome, ES Cell Differentiation/IPS, Transcription Factors
Summary This gene encodes a protein which belongs to the GATA family of transcription factors. The protein plays an important role in erythroid development by regulating the switch of fetal hemoglobin to adult hemoglobin. Mutations in this gene have been associated with X-linked dyserythropoietic anemia and thrombocytopenia. [provided by RefSeq, Jul 2008]
Write Your Own Review
You're reviewing:GATA1 (NM_002049) Human Untagged Clone
Your Rating
SKU Description Size Price
RC224854 GATA1 (Myc-DDK-tagged)-Human GATA binding protein 1 (globin transcription factor 1) (GATA1) 10 ug
$457.00
RC224854L1 Lenti ORF clone of Human GATA binding protein 1 (globin transcription factor 1) (GATA1), Myc-DDK-tagged 10 ug
$757.00
RC224854L2 Lenti ORF clone of Human GATA binding protein 1 (globin transcription factor 1) (GATA1), mGFP tagged 10 ug
$757.00
RC224854L3 Lenti ORF clone of Human GATA binding protein 1 (globin transcription factor 1) (GATA1), Myc-DDK-tagged 10 ug
$757.00
RC224854L4 Lenti ORF clone of Human GATA binding protein 1 (globin transcription factor 1) (GATA1), mGFP tagged 10 ug
$757.00
RG224854 GATA1 (tGFP-tagged) - Human GATA binding protein 1 (globin transcription factor 1) (GATA1) 10 ug
$489.00 MSRP $657.00 MSRP $657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.