IRF1 (NM_002198) Human Untagged Clone

CAT#: SC118744

IRF1 (untagged)-Human interferon regulatory factor 1 (IRF1)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name IRF1 (NM_002198) Human Untagged Clone
Symbol IRF1
Synonyms IRF-1; MAR
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_002198, the custom clone sequence may differ by one or more nucleotides


ATGCCCATCACTCGGATGCGCATGAGACCCTGGCTAGAGATGCAGATTAATTCCAACCAAATCCCGGGGC
TCATCTGGATTAATAAAGAGGAGATGATCTTCCAGATCCCATGGAAGCATGCTGCCAAGCATGGCTGGGA
CATCAACAAGGATGCCTGTTTGTTCCGGAGCTGGGCCATTCACACAGGCCGATACAAAGCAGGGGAAAAG
GAGCCAGATCCCAAGACGTGGAAGGCCAACTTTCGCTGTGCCATGAACTCCCTGCCAGATATCGAGGAGG
TGAAAGACCAGAGCAGGAACAAGGGCAGCTCAGCTGTGCGAGTGTACCGGATGCTTCCACCTCTCACCAA
GAACCAGAGAAAAGAAAGAAAGTCGAAGTCCAGCCGAGATGCTAAGAGCAAGGCCAAGAGGAAGTCATGT
GGGGATTCCAGCCCTGATACCTTCTCTGATGGACTCAGCAGCTCCACTCTGCCTGATGACCACAGCAGCT
ACACAGTTCCAGGCTACATGCAGGACTTGGAGGTGGAGCAGGCCCTGACTCCAGCACTGTCGCCATGTGC
TGTCAGCAGCACTCTCCCCGACTGGCACATCCCAGTGGAAGTTGTGCCGGACAGCACCAGTGATCTGTAC
AACTTCCAGGTGTCACCCATGCCCTCCACCTCTGAAGCTACAACAGATGAGGATGAGGAAGGGAAATTAC
CTGAGGACATCATGAAGCTCTTGGAGCAGTCGGAGTGGCAGCCAACAAACGTGGATGGGAAGGGGTACCT
ACTCAATGAACCTGGAGTCCAGCCCACCTCTGTCTATGGAGACTTTAGCTGTAAGGAGGAGCCAGAAATT
GACAGCCCAGGGGGGGATATTGGGCTGAGTCTACAGCGTGTCTTCACAGATCTGAAGAACATGGATGCCA
CCTGGCTGGACAGCCTGCTGACCCCAGTCCGGTTGCCCTCCATCCAGGCCATTCCCTGTGCACCGTAG


5' Read Nucleotide Sequence
>OriGene 5' read for NM_002198 unedited
TTTTGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGCTTAGTCGAGGCA
AGACGTGCGCCCGAGCCCCGCCGAACCGAGGCCACCCGGAGCCGTGCCCAGTCCACGCCG
GCCGTGCCCGGCGGCCTTAAGAACCCGGCAACCTCTGCCTTCTTCCCTCTTCCACTCGGA
GTCGCGCTTCGCGCGCCCTCACTGCAGCCCCTGCGTCGCCGGGACCCTCGCGCGCGACCG
CCGAATCGCTCCTGCAGCAGAGCCAACATGCCCATCACTCGGATGCGCATGAGACCCTGG
CTAGAGATGCAGATTAATTCCAACCAAATCCCGGGGCTCATCTGGATTAATAAAGAGGAG
ATGATCTTCCAGATCCCATGGAAGCATGCTGCCAAGCATGGCTGGGACATCAACAAGGAT
GCCTGTTTGTTCCGGAGCTGGGCCATTCACACAGGCCGATACAAAGCAGGGGAAAAGGAG
CCAGATCCCAAGACGTGGAAGGCCAACTTTCGCTGTGCCATGAACTCCCTGCCAGATATC
GAGGAGGTGAAAGACCAGAGCAGGAACAAGGGCAGCTCAGCTGTGCGAGTGTACCGGATG
CTTCCACCTCTCACCAAGAACCAGAGAAAAGAAAGAAGGTTCGAAGTCCAGCCGAGATGC
TAAGAGCAAGGCCAGNNAGGAAGTCATGTGGGGGGATTCCAGCCCTGATACCTTCTCTGA
TGGACTCAGCAGCTCCACTCTGCCTGATGACCACAGCACCTACACAGTTCCAGGCTCATG
CAGACTTTGGGAGGGGGGAACAGGCCCTGACTCACCTGGNNNCCCCGGGTGCTGTCACAG
CACTCTCCCCGACTGCACATCCAAANGGGAAAGGTGGCGCGGACAGACCCCGGGATCTGT
CAACT
3' Read Nucleotide Sequence
>OriGene 3' read for NM_002198 unedited
GGCACGCAATCTAAAGTCGAGTTTTTTTTTTTTTTTTTTTTTTGGGGCCCGGGCTGGAGT
GCAATGGCATGTTCTCGGCTCACTGCAACCTCCACCTCCCAGGTTCAAGCGATTCTCTTG
CCTCAGCCTCCTGAGTAGCTGGGATTACAAGCACCCGCAACCACGCCCAGCTAATTTTTG
CATTTTTAGTAAAAATGGAGTTTCACCAGGCTGGTCTCAAACTCCTGACCTCAGGTGATC
CACCCATCTCGGCCTCCCAAAGTGCTGGGATTACAGGTGTGAGCCACCGCGCCTGTCCGA
AAGGATTTTATAACAGATGCATGTCCCTGTTCACCCCAAAGTCAAGTTCAAGCGGGATGC
CAATAATAAGTCCATCAGTGTTTCCATAAAAAGTAAAATCATCTACAAGGCAAATTTCTC
TCTAAAAAGGCCACACCCTTATAAACAATTTACTTTTTTATAAAAAGACAAATGTACATA
TTTACACACGTCCTTATGTGTTCACACATGACTTAAAGGCTAAATGACATTTACAATTTT
AAGTTATACCAAGGCGCCTCACACTTACCTCCCTGGGCCCTGTTGAAGGCCTGCTGGGGC
TTGAAGGGGCGGTGGGCCCCTAGCCACGCCCTGTTTAAATAAACGCAAAGGCCAAAATCT
CGGTGGAAAAGTTAATGCTCACCCCTGATCAAAATGTGGCTTGATCCCACCAAAAATTCC
AATTGTTTTTCCCACTCCCCCCCCCATCAGGAGCCCAGGACACCCCTCTGAGGCTGAGGA
ACCCTGCCCAGAAGAACCCCTTTTCCTCAATATACCGCGTTTGGAACACACCCCCGGCTA
TTTTAAATGGGGTTATTTTTTGCAACCAAATATATATCGCCATTTTTTTACCGCATACCC
ACCTGGATCGTGCCTTACACCCTGCGCCCCCGCCCGATCCCAGTCACATCCTTTTCNTTA
TACCCCTTCACACCGGAC
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_002198
ORF Size 978 bp
Insert Size 2600
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_002198.1, NP_002189
RefSeq Size 2035
Locus ID 3659
Cytogenetics 5q31.1
Domains IRF
Protein Families Transcription Factors, Druggable Genome
Gene Summary IRF1 encodes interferon regulatory factor 1, a member of the interferon regulatory transcription factor (IRF) family. IRF1 serves as an activator of interferons alpha and beta transcription, and in mouse it has been shown to be required for double-stranded RNA induction of these genes. IRF1 also functions as a transcription activator of genes induced by interferons alpha, beta, and gamma. Further, IRF1 has been shown to play roles in regulating apoptosis and tumor-suppressoion. [provided by RefSeq, Jul 2008].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations