MLC1SA (MYL6B) (NM_002475) Human Untagged Clone

CAT#: SC118607

Reviews ()
Write a review

MYL6B (untagged)-Human myosin, light chain 6B, alkali, smooth muscle and non-muscle (MYL6B), transcript variant 2



Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product images

Other products for "MYL6B"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MYL6B
Synonyms MLC1SA
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC118607 sequence for NM_002475 edited (data generated by NextGen Sequencing)
ATGCCTCCCAAGAAGGATGTTCCCGTGAAGAAACCAGCAGGGCCCTCCATCTCCAAACCT
GCTGCTAAGCCAGCAGCAGCAGGGGCTCCTCCAGCCAAGACCAAAGCTGAGCCAGCTGTC
CCCCAGGCCCCTCAGAAAACCCAGGAGCCTCCAGTCGATCTCTCCAAAGTGGTGATCGAG
TTTAACAAGGACCAGCTGGAGGAGTTCAAGGAGGCCTTCGAGCTGTTTGACCGAGTGGGG
GATGGCAAGATCCTGTACAGCCAGTGTGGGGACGTGATGAGGGCCCTGGGCCAGAACCCC
ACCAACGCCGAGGTGCTCAAGGTCCTGGGGAACCCCAAGAGTGATGAGCTGAAGTCGCGG
CGTGTGGACTTTGAGACTTTCCTGCCCATGCTCCAGGCAGTGGCCAAGAACCGAGGCCAA
GGCACATATGAGGACTACTTGGAGGGGTTTCGTGTGTTTGACAAGGAGGGGAACGGCAAA
GTCATGGGAGCAGAGCTCAGACATGTTCTCACCACCCTTGGAGAGAAGATGACTGAGGAG
GAGGTGGAGACCGTTCTGGCAGGACACGAGGACAGCAACGGCTGCATCAACTACGAGGCC
TTCTTGAAACACATCCTAAGCGTCTGA

Clone variation with respect to NM_002475.4
>OriGene 5' read for NM_002475 unedited
GAACGTCAAATTTTGTATACCATCATATAGGGCGGCCGCGAATTCGCACGAGGGAGATGG
GTGCCCCCATCCGCACACTGTCCTTTGGCCACCGGACATCATGCCTCCCAAGAAGGATGT
TCCCGTGAAGAAACCAGCAGGGCCCTCCATCTCCAAACCTGCTGCTAAGCCAGCAGCAGC
AGGGGCTCCTCCAGCCAAGACCAAAGCTGAGCCAGCTGTCCCCCAGGCCCCTCAGAAAAC
CCAGGAGCCTCCAGTCGATCTCTCCAAAGTGGTGATCGAGTTTAACAAGGACCAGCTGGA
GGAGTTCAAGGAGGCCTTCGAGCTGTTTGACCGAGTGGGGGATGGCAAGATCCTGTACAG
CCAGTGTGGGGACGTGATGAGGGCCCTGGGCCAGAACCCCACCAACGCCGAGGTGCTCAA
GGTCCTGGGGAACCCCAAGAGTGATGAGCTGAAGTCGCGGCGTGTGGACTTTGAGACTTT
CCTGCCCATGCTCCAGGCAGTGGCCAAGAACCGAGGCCAAGGCACATATGAGGACTACTT
GGAGGGGTTTCGTGTGTTTGACAAGGAGGGGAACGGCAAAGTCATGGGAGCAGAGCTCAG
ACATGTTCTCACCACCCTTGGAGAGAAGATGACTGAGGAGGAGGTGGAGACCGTTCTGGC
AGGACACGAGGACAGCAACGGCTGCATCAACTACGAGGCCTTCTTGAAACACATCCTAAG
CGTCTGAGTGCTGCAGATCCAGTGGGGTCCGGACACTGGGCCCCCGCAGCGAAAGCACGT
TCCAGCCACCAGNAGGCCACCTATTGTTTCAAAATAAAGACTGGGTTCCTCTCTTTGGAA
AAAANNNNNNGNAGGNAANNAAAGAAAAAANAAAAGAGAGANNGAAAAAGAGAGC
>OriGene 3' read for NM_002475 unedited
GGTGGAGCCCATCTTCTTTTTAAACATGGTGGCCTCCTGGTGGCTGGAACGTGCTTTCGC
CTGCGGGGCCCAGTGTCCGGACCCCACTGGATCTGCAGCACTCAGACGCTTAGGATGTGT
TTCAAGAAGGCCTCGTAGTTGATGCAGCCGTTGCTGTCCTCGTGTCCTGCCAGAACGGTC
TCCACCTCCTCCTCAGTCATCTTCTCTCCAAGGGTGGTGAGAACATGTCTGAGCTCTGCT
CCCATGACTTTGCCGTTCCCCTCCTTGTCAAACACACGAAACCCCTCCAAGTAGTCCTCA
TATGTGCCTTGGCCTCGGTTCTTGGCCACTGCCTGGAGCATGGGCAGGAAAGTCTCAAAG
TCCACACGCCGCGACTTCAGCTCATCACTCTTGGGGTTCCCCAGGACCTTGAGCACCTCG
GCGTTGGTGGGGTTCTGGCCCAGGGCCCTCATCACGTCCCCACACTGGCTGTACAGGATC
TTGCCATCCCCCACTCGGTCAAACAGCTCGAAGGCCTCCTTGAACTCCTCCAGCTGGTCC
TTGTTAAACTCGATCACCACTTTGGAGAGATCGACTGGAGGCTCCTGGGCTTTCTGAGGG
GCCTGGGGGACAGCTGGCTCCACCTTGGTCTTGCCTGGAGGACCCCCTGCTGCTGCTGGC
TTCACCCCCGGTTCGGCGATGGCGGGCCCTGCTGGTTTCCTTCCCCGTACCATCCCTCTC
TGGGTGGCCTGCTGTTCCCGGGGCCCCCCCGACACGTCGCCGGCTGGGGGTCCCTCTTCT
CCTTTGTGTTCAAATTCTCGCCCCCCCTTTCTCTGTTTCTGTCTCCATATTTCTCGCGGC
CCCCTTTAATCTTCTCTGCTTTTTTCGACCTTCCCCGTTCCTCCCCTATCGCCCTTTTTC
CGTTCCGTGGCCCGCGGCTTCTCCCCCTTTCCGAACAACCCCAAA
Restriction Sites NotI-NotI     
ACCN NM_002475
Insert Size 850 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_002475.2, NP_002466.1
RefSeq Size 778 bp
RefSeq ORF 627 bp
Locus ID 140465
UniProt ID P14649
Cytogenetics 12q13.2
Domains EFh
Protein Pathways Vascular smooth muscle contraction
Gene Summary Myosin is a hexameric ATPase cellular motor protein. It is composed of two heavy chains, two nonphosphorylatable alkali light chains, and two phosphorylatable regulatory light chains. This gene encodes a myosin alkali light chain expressed in both slow-twitch skeletal muscle and in nonmuscle tissue. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2010]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same protein.
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.