PMP70(ABCD3) (NM_002858) Human Untagged Clone

CAT#: SC118377

ABCD3 (untagged)-Human ATP-binding cassette, sub-family D (ALD), member 3 (ABCD3), transcript variant 1

USD 1,051.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name PMP70(ABCD3) (NM_002858) Human Untagged Clone
Symbol ABCD3
Synonyms ABC43; CBAS5; PMP70; PXMP1; ZWS2
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC118377 sequence for NM_002858 edited (data generated by NextGen Sequencing)
ATGGCGGCCTTCAGCAAGTACTTGACGGCGCGAAACTCCTCGCTGGCTGGTGCCGCGTTC
CTGCTGCTCTGCCTGCTCCACAAGCGGCGCCGCGCCCTCGGCCTGCACGGTAAGAAAAGT
GGAAAACCACCATTACAGAACAATGAGAAAGAGGGGAAAAAGGAGCGAGCTGTGGTGGAC
AAGGTGTTTTTCTCAAGGCTCATACAGATTCTGAAAATCATGGTCCCTAGAACATTTTGT
AAAGAGACAGGTTACTTGGTACTTATTGCTGTTATGCTGGTGTCTCGAACATATTGTGAT
GTTTGGATGATTCAAAATGGGACACTAATTGAAAGTGGTATCATTGGTCGTAGCAGGAAA
GATTTCAAGAGATACTTACTCAACTTCATCGCTGCCATGCCTCTTATCTCTCTGGTTAAT
AACTTCTTGAAGTATGGGTTAAATGAGCTTAAACTGTGCTTCCGAGTAAGGCTCACTAAA
TACCTCTATGAGGAGTATCTTCAAGCTTTCACATATTATAAAATGGGGAATCTGGACAAC
AGAATAGCTAATCCAGACCAGCTGCTTACACAAGATGTAGAAAAATTTTGTAACAGTGTA
GTCGATCTGTATTCAAATCTTAGTAAGCCATTTTTAGACATAGTTTTGTATATCTTTAAG
TTAACGAGTGCAATTGGAGCTCAGGGCCCAGCGAGCATGATGGCCTACTTGGTTGTTTCT
GGGCTATTCCTAACTCGACTTCGAAGACCCATTGGTAAGATGACAATAACTGAGCAAAAG
TATGAAGGAGAATATAGATATGTTAATTCTCGGCTCATCACAAACAGTGAAGAAATTGCC
TTTTACAATGGGAATAAAAGAGAAAAGCAGACAGTCCACTCAGTCTTCCGAAAACTGGTG
GAACACCTACATAATTTCATTTTGTTTCGGTTTTCAATGGGCTTCATTGATAGTATTATT
GCCAAATACCTTGCCACTGTTGTTGGTTACCTAGTTGTCAGTCGCCCTTTCTTAGATTTG
TCTCATCCTCGACATCTCAAGAGTACACATTCGGAACTTCTAGAGGATTACTACCAAAGT
GGAAGAATGCTTTTGCGAATGTCTCAAGCTCTGGGTCGAATAGTTTTGGCTGGGCGTGAA
ATGACTAGATTGGCCGGTTTTACTGCTCGGATTACAGAATTAATGCAAGTACTGAAGGAT
TTAAATCATGGCAAATATGAGCGCACAATGGTCTTACAACAGGAAAAGGGTATTGAAGGA
GTACAAGTCATTCCCTTGATACCTGGTGCTGGAGAAATCATTATTGCAGATAACATTATA
AAGTTTGATCATGTTCCTTTAGCAACGCCAAATGGAGATGTTTTGATCCGAGACCTTAAT
TTTGAAGTTCGATCTGGGGCTAATGTTCTAATTTGTGGTCCAAATGGCTGCGGAAAGAGT
TCACTTTTCCGTGTTCTTGGTGAATTATGGCCTCTTTTTGGAGGACGTCTAACTAAACCT
GAAAGAGGAAAATTATTTTATGTTCCTCAGAGACCTTACATGACCCTTGGAACACTTCGA
GATCAAGTGATATATCCAGATGGACGAGAAGATCAGAAAAGGAAGGGAATTTCTGACCTA
GTACTGAAGGAATACTTAGACAATGTCCAGTTGGGTCATATCCTTGAACGTGAAGGAGGC
TGGGACAGTGTTCAGGATTGGATGGACGTACTCAGTGGTGGAGAAAAGCAAAGAATGGCG
ATGGCAAGATTATTTTATCATAAACCCCAGTTTGCCATTTTGGATGAATGCACAAGTGCA
GTTAGTGTCGACGTGGAAGGCTACATTTATAGTCATTGTCGAAAGGTTGGCATCACTCTC
TTCACTGTGTCTCATAGGAAATCTCTTTGGAAACATCATGAGTACTACCTGCATATGGAT
GGCAGAGGCAACTATGAATTCAAACAGATAACAGAAGATACAGTTGAGTTTGGCTCTTAG

Clone variation with respect to NM_002858.3
1235 c=>t
5' Read Nucleotide Sequence
>OriGene 5' read for NM_002858 unedited
ACACCAATTCCGCACGAGGCCTCGTGCCTAATTCGGCACGAGGGCTGCGTGCAGTAAGGT
AGCCGCCGCCGCCGCCGCCGCCGCGTCCCCTCGCCGGCTCGCTGGTACCGGCAGTGCCAT
GGCGGCCTTCAGCAAGTACTTGACGGCGCGAAACTCCTCGCTGGCTGGTGCCGCGTTCNG
TTGCTTTGCCTGCTCCACAAGCGGCGCCGCGCCCTCGGCCTGCACGGTAAGAAAAGTGGA
AAACCACCATTACAGAACAATGAGAAAGAGGGGAAAAAGGAGCGAGCTGTGGTGGACAAG
GTGTTTTTCTCAAGGCTCATACAGATTCTGAAAATCATGGTCCCTAGAACATTTTGTAAA
GAGACAGGTTACTTGGTACTTATTGCTGTTATGCTGGTGTCTCGAACATATTGTGATGTT
TGGATGATTCAAAATGGGACACTAATTGAAAGTGGTATCATTGGTCGTAGCAGGAAAGAT
TTCAAGAGATACTTACTCAACTTCATCGCTGCCATGCCTCTTATCTCTCTGGTTAATAAC
TTCTTGAAGTATGGGTTAAATGAGCTTAAACTGTGCTTCCGAGTAAGGCTCACTAAATAC
CTCTATGAGGAGTATCTTCAAGCTTTCACATATTATAAAATGGGGAATCTGGACAACAGA
ATAGCTAATCCAGACCAGCTGCTTACACAAGATGTAGAAAAATTTTGTAACAGTGTAGTC
GATCTGTATTCAAATCTTATAAGCCATTTTTTAGACTAGTTTTGTATATCTTTAAGTTAA
CGAGTGCAATTGGAGCTCAGGGCCCCAGCGAGCATGATGGCCTACCTGGNTGTTTTCTGG
GCTATTCTTAACTCCACTTCAAGAACCAATGGTTAGATGACATTACTGAGCAN
3' Read Nucleotide Sequence
>OriGene 3' read for NM_002858 unedited
CGCAATCTAGAGTCGAGTTTTTTTTTTTTTTTTTTGATCTGAACAGAAAAAAGTATACAA
GTTCGCTAAACAGAAGTGGTAAAAATTGAATGTTATGTATTATGGAATTCAGTACATCAG
TTTACTTCGGTAGCCAGTGATTGTTATAGTTAATTCTGCAAAAAAACAAAACCAGTTATG
CAAAAACAAGAGTACAAAATGCCCCTTTCTGAAGCTCAGTTTGAGAAACTGATTTCGTAT
CTAGCTTATTGATTATACTCAGTTTCAATTCTCCCTGTGCAAATAATACATAAAGTCATT
AATGATGATTTGATGAACTGAAATCATCTTCGCTTAGGATCGTTTGACATCATAACCCAA
ATATAAAAAAGTTATTCAAGATTCACAGAGATAAAACAGTGCCTCGGAAACATAATTCAC
CCATGTATATATAATAATTTTAGAACATACTTTTTAAACATAAAATCACAGTCAAAGACA
GTGATAGCATTGCATACTCAGTGCATTATTTCATGTAGTGCCTTCCTATGGCTCATTTGG
AGTTTAATACCAAATAACCACCACACTTCTAATGAATGGGCTTCTAACACACACAAATTT
GTCTAATTCTCTTAAAAATCTAGAACTCTTATAAGACCTTGAGCCTGGCATGTTAAGGAC
TTTGTGTTTTAATATCCCAAACATTGGGAAGATTANGTGTGATACATGGTAACCCCCTNC
TTTGTAGCAAGACTGCACATATACTTTAAACAACTCAATACTGCAGACTGAGAAGGGTAC
ATTTATCATTTAGTTAAGGAAAACCAAATGGCCTTTCCTGGAGGTAATGCACTCCCAGAC
CACACAAGGATGAGTATACTGGGCAGCTAAGAAATTGCCCTGATAATAACCTGTATGCAT
GATGTAACATTTATAATCATATGATCGTTCCACTACCAGGCACAGAAAATGACTGAGACT
TCTGCTAACGGCAATGAGACCAGTTTATAAGGTCTACTGAG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_002858
ORF Size 1980 bp
Insert Size 3160
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_002858.2, NP_002849
RefSeq Size 3423
Locus ID 5825
Cytogenetics 1p21.3
Domains ABC_tran, AAA
Protein Families Transmembrane, Druggable Genome
Protein Pathways ABC transporters
Gene Summary The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ALD subfamily, which is involved in peroxisomal import of fatty acids and/or fatty acyl-CoAs in the organelle. All known peroxisomal ABC transporters are half transporters which require a partner half transporter molecule to form a functional homodimeric or heterodimeric transporter. This peroxisomal membrane protein likely plays an important role in peroxisome biogenesis. Mutations have been associated with some forms of Zellweger syndrome, a heterogeneous group of peroxisome assembly disorders. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008].
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.