Sortilin (SORT1) (NM_002959) Human Untagged Clone

CAT#: SC118300

Reviews ()
Write a review

SORT1 (untagged)-Human sortilin 1 (SORT1), transcript variant 1



  "NM_002959" in other vectors (6)

USD 477.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SORT1
Synonyms Gp95; LDLCQ6; NT3; NTR3
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_002959 edited
GGCGGGCGCGCCGGGCGGCAGGTGTCGGCGTCGGCGGCATTCGGCGGCGATGGAGCGGCC
CTGGGGAGCTGCGGACGGCCTCTCGCGCTGGCCCCATGGCCTCGGCCTCCTCCTCCTCCT
GCAGCTGCTGCCGCCGTCGACCCTCAGCCAGGACCGGCTGGACGCGCCGCCGCCGCCCGC
TGCGCCGCTGCCGCGCTGGTCTGGCCCCATCGGGGTGAGCTGGGGGCTGCGGGCGGCCGC
AGCCGGGGGCGCGTTTCCCCGCGGCGGCCGTTGGCGTCGCAGCGCGCCGGGCGAGGACGA
GGAGTGCGGCCGGGTCCGGGACTTCGTCGCCAAGCTGGCCAACAACACGCACCAGCATGT
GTTTGATGATCTCAGAGGCTCAGTATCCTTGTCCTGGGTTGGAGATAGCACTGGGGTCAT
TCTAGTCTTGACTACCTTCCATGTACCACTGGTAATTATGACTTTTGGACAGTCCAAGCT
ATATCGAAGTGAGGATTATGGGAAGAACTTTAAGGATATTACAGATCTCATCAATAACAC
CTTTATTCGGACTGAATTTGGCATGGCTATTGGTCCTGAGAACTCTGGAAAGGTGGTGTT
AACAGCAGAGGTGTCTGGAGGAAGTCGTGGAGGAAGAATCTTCAGATCATCAGATTTTGC
GAAGAATTTTGTGCAAACAGATCTCCCTTTTCATCCTCTCACTCAGATGATGTATAGCCC
TCAGAATTCTGATTATCTTTTAGCTCTCAGCACTGAAAATGGCCTGTGGGTGTCCAAGAA
TTTTGGGGGAAAATGGGAAGAAATCCACAAAGCAGTATGTTTGGCCAAATGGGGATCAGA
CAACACCATCTTCTTTACAACCTATGCAAATGGCTCCTGCAAAGCTGACCTTGGGGCTCT
GGAATTATGGAGAACTTCAGACTTGGGAAAAAGCTTCAAAACTATTGGTGTGAAAATCTA
CTCATTTGGTCTTGGGGGACGTTTCCTTTTTGCCTCTGTGATGGCTGATAAGGATACCAC
AAGAAGGATCCACGTTTCAACAGATCAAGGGGACACATGGAGCATGGCCCAGCTCCCCTC
CGTGGGACAGGAACAGTTCTATTCTATTCTGGCAGCAAATGATGACATGGTATTCATGCA
TGTAGATGAACCTGGAGACACTGGGTTTGGCACAATCTTTACCTCAGATGATCGAGGCAT
TGTCTATTCCAAGTCTTTGGACCGACATCTCTACACTACCACAGGCGGAGAGACGGACTT
TACCAACGTGACCTCCCTCCGCGGCGTCTACATAACAAGCGTGCTCTCCGAAGATAATTC
TATCCAGACCATGATCACTTTTGACCAAGGAGGAAGGTGGACGCACCTGAGGAAGCCTGA
AAACAGTGAATGTGATGCTACAGCAAAAAACAAGAATGAGTGCAGCCTTCATATTCATGC
TTCCTACAGCATCTCCCAGAAACTGAATGTTCCAATGGCCCCACTCTCAGAGCCGAATGC
CGTAGGCATTGTCATTGCTCATGGTAGCGTGGGGGATGCCATCTCAGTGATGGTTCCAGA
TGTGTACATCTCAGATGATGGGGGTTACTCCTGGACAAAGATGCTGGAAGGACCCCACTA
TTACACCATCCTGGATTCTGGAGGCATCATTGTGGCCATTGAGCACAGCAGCCGTCCTAT
CAATGTGATTAAGTTCTCCACAGACGAAGGTCAATGCTGGCAAACCTACACGTTCACCAG
GGACCCCATCTATTTCACTGGCCTAGCTTCAGAACCTGGAGCTAGGTCCATGAATATCAG
CATTTGGGGCTTCACAGAATCTTTCCTGACCAGCCAGTGGGTCTCCTACACCATTGATTT
TAAAGATATCCTTGAAAGGAACTGTGAAGAGAAGGACTATACCATATGGCTGGCACACTC
CACAGACCCTGAAGATTATGAAGATGGCTGCATTTTGGGCTACAAAGAACAGTTTCTGCG
GCTACGCAAGTCATCCGTGTGTCAGAATGGTCGAGACTATGTTGTGACCAAGCAGCCCTC
CATCTGCCTCTGTTCCCTGGAGGACTTTCTCTGTGATTTTGGCTACTACCGTCCAGAAAA
TGACTCCAAGTGTGTGGAACAGCCAGAACTGAAGGGCCACGACCTGGAGTTTTGTCTGTA
CGGAAGAGAAGAACACCTAACAACAAATGGGTACCGGAAAATTCCAGGGGACAAATGCCA
GGGTGGGGTAAATCCAGTTCGAGAAGTAAAAGACTTGAAAAAGAAATGCACAAGCAACTT
TTTGAGTCCGGAAAAACAGAATTCCAAGTCAAATTCTGTTCCAATTATCCTGGCCATCGT
GGGATTGATGCTGGTCACAGTCGTAGCAGGAGTGCTCATTGTGAAGAAATATGTCTGTGG
GGGAAGGTTCCTGGTGCATCGATACTCTGTGCTGCAGCAGCATGCAGAGGCCAATGGTGT
GGATGGTGTGGATGCTTTGGACACAGCCTCCCACACTAATAAAAGTGGTTATCATGATGA
CTCAGATGAGGACCTCTTGGAATAGCTCTTCAGAGGAGCTGGACCCAGCATGGATGGTGG
AACCACAGTACCTCTTACACTCCCTGTGGCTCCAACTTCAGGAAATAAATTTCCCATTGC
GAGGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_002959
Insert Size 2700 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_002959.4.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_002959.4, NP_002950.3
RefSeq Size 7018 bp
RefSeq ORF 2496 bp
Locus ID 6272
UniProt ID Q99523
Cytogenetics 1p21.3-p13.1
Domains BNR, VPS10
Protein Families Druggable Genome, Transmembrane
Protein Pathways Lysosome, Neurotrophin signaling pathway
Gene Summary This gene encodes a member of the VPS10-related sortilin family of proteins. The encoded preproprotein is proteolytically processed by furin to generate the mature receptor. This receptor plays a role in the trafficking of different proteins to either the cell surface, or subcellular compartments such as lysosomes and endosomes. Expression levels of this gene may influence the risk of myocardial infarction in human patients. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.