mtTFA(TFAM) (NM_003201) Human Untagged Clone

CAT#: SC118128

TFAM (untagged)-Human transcription factor A, mitochondrial (TFAM), nuclear gene encoding mitochondrial protein

USD 402.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name mtTFA(TFAM) (NM_003201) Human Untagged Clone
Symbol TFAM
Synonyms MTTF1; MTTFA; TCF6; TCF6L1; TCF6L2; TCF6L3
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC118128 sequence for NM_003201 edited (data generated by NextGen Sequencing)
ATGGCGTTTCTCCGAAGCATGTGGGGCGTGCTGAGTGCCCTGGGAAGGTCTGGAGCAGAG
CTGTGCACCGGCTGTGGAAGTCGACTGCGCTCCCCCTTCAGTTTTGTGTATTTACCGAGG
TGGTTTTCATCTGTCTTGGCAAGTTGTCCAAAGAAACCTGTAAGTTCTTACCTTCGATTT
TCTAAAGAACAACTACCCATATTTAAAGCTCAGAACCCAGATGCAAAAACTACAGAACTA
ATTAGAAGAATTGCCCAGCGTTGGAGGGAACTTCCTGATTCAAAGAAAAAAATATATCAA
GATGCTTATAGGGCGGAGTGGCAGGTATATAAAGAAGAGATAAGCAGATTTAAAGAACAG
CTAACTCCAAGTCAGATTATGTCTTTGGAAAAAGAAATCATGGACAAACATTTAAAAAGG
AAAGCTATGACAAAAAAAAAAGAGTTAACACTGCTTGGAAAACCAAAAAGACCTCGTTCA
GCTTATAACGTTTATGTAGCTGAAAGATTCCAAGAAGCTAAGGGTGATTCACCGCAGGAA
AAGCTGAAGACTGTAAAGGAAAACTGGAAAAATCTGTCTGACTCTGAAAAGGAATTATAT
ATTCAGCATGCTAAAGAGGACGAAACTCGTTATCATAATGAAATGAAGTCTTGGGAAGAA
CAAATGATTGAAGTTGGACGAAAGGATCTTCTACGTCGCACAATAAAGAAACAACGAAAA
TATGGTGCTGAGGAGTGTTAA

Clone variation with respect to NM_003201.1
5' Read Nucleotide Sequence
>OriGene 5' read for NM_003201 unedited
TGTAATACGACTCACTATAGGGCGGCCGCNGATTCGGCACGAGGATAACACACGCCGGAG
GGTCGCACGCGGGTTCCAGTTGTGATTGCTGGAGTTGTGTATTGCCAGGAGGCTCTCCGA
GATTGGGGTCGGGTCACTGCCTCATCCACCGGAGCGATGGCGTTTCTCCGAAGCATGTGG
GGCGTGCTGAGTGCCCTGGGAAGGTCTGGAGCAGAGCTGTGCACCGGCTGTGGAAGTCGA
CTGCGCTCCCCCTTCAGTTTTGTGTATTTACCGAGGTGGTTTTCATCTGTCTTGGCAAGT
TGTCCAAAGAAACCTGTAAGTTCTTACCTTCGATTTTCTAAAGAACAACTACCCATATTT
AAAGCTCAGAACCCAGATGCAAAAACTACAGAACTAATTAGAAGAATTGCCCAGCGTTGG
AGGGAACTTCCTGATTCAAAGAAAAAAATATATCAAGATGCTTATAGGGCGGAGTGGCAG
GTATATAAAGAAGAGATAAGCAGATTTAAAGAACAGCTAACTCCAAGTCAGATTATGTCT
TTGGAAAAAGAAATCATGGACAAACATTTAAAAAGGAAAGCTATGACAAAAAAAAAAGAG
TTAACACTGCTTGGAAAAACCAAAAAGACCTCGTTCAGCTTATAACGTTTATGTAGCTGA
AAGATTCCAAGAAGCTAAGGGTGATTCACCGNCAGAAAAAGCTGAGACTGGTAAGCANAA
CTGCGANAATCTGTCTGACTCTGAANAGGAAATATATATTCAGCATGCTAAAGAAAACGA
AACTCGTTATCATAATGAAATGAAGTCTCGCGAAGAACAAATGATTGNAAGTGGACGAAA
GGATCCTCTACGTCGCACAATAAAGGAACAACGAAATAATGTGCTGAGGAGTGTTAAAGT
ANAAGATGANNAGGGCTCCCATGGNATAGCCCAGNAACCCT
3' Read Nucleotide Sequence
>OriGene 3' read for NM_003201 unedited
TGGAACGCAGGCCGCAATCTAGAGTCGAGTTTTTTTTTTTTTTTTTTGGTTGTGTTTCAA
CAAACTTTATTTATGAACACTAAATATTCATGTTAATTTTCAAGTATCATAAAAGTCTTT
AAAAAAAAACATTTAAAATTATAAACACAATTCCTAGCTCACAGGCCATAAAAAGCAGGC
AGCAGGCTGGATTTGATCCACAGGCCATAGTTGGCTGTCTCTTAAACAGGCTTTTATACG
TTATGCAAAGTGTTTCAAATTCCAGAGACTTTGGAGACTTTTCGTTTTTTAGATTTCTCA
TTTTAAAACACACATAATACAAGTTTTCTTTCTGGATCAATATACTCACGAGAGAAAATA
ATTCAGAAAAAAATAAAATTCCTTACTTAAAAAAAGGGAAAAGCTATAGAACAAATGTTT
CGTCTTAAAATATATTTAGGAAATGTAAAATTAAAGATTAAAAATTTTATTCTATGCAAC
ATAAAATAATATGCATAAATCTGGCACATAATTTCTTTGTTTTTACTTTAGAAAAAAGAC
AGTAAGAAAAAAGTTTATAAATTTCTCAGTCCCTTTTATACAAAGTTGCAACTAAAACCA
GCAATCACTTATATGTACAACCATCAACTCTGAATACAATGTGAATTATACCTAGGAACT
GTAATTTACCTAGATGAGTTCTGCCTGCTTTATGAAAAACACACACTTATATCACAGAAC
ACCGTGGCTTCTACAATTTGTAACAATTTTGAAAACGAAACTCCTGCCTCCATAATATAA
GGAAACAAGAGTACTCTTTCCATAGTCATCATCCTGTATAAAAAAAACTTCATAGTCTGA
TTTACCTTTGNCAAAGGTANAATGATTCACATTTGCTTGGGATACTCTGATCCTCAGAGG
TCCTAAACACAAATAAAGTTTGCATGC
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_003201
ORF Size 741 bp
Insert Size 1920
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_003201.1, NP_003192
RefSeq Size 1936
Locus ID 7019
Cytogenetics 10q21.1
Domains HMG
Protein Families Transcription Factors, Druggable Genome
Protein Pathways Huntington's disease
Gene Summary This gene encodes a key mitochondrial transcription factor containing two high mobility group motifs. The encoded protein also functions in mitochondrial DNA replication and repair. Sequence polymorphisms in this gene are associated with Alzheimer's and Parkinson's diseases. There are pseudogenes for this gene on chromosomes 6, 7, and 11. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Transcript Variant: This variant (1, also known as ref) encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations