UBE2G2 (NM_003343) Human Untagged Clone

SKU
SC118048
UBE2G2 (untagged)-Human ubiquitin-conjugating enzyme E2G 2 (UBE2G2), transcript variant 1
$150.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol UBE2G2
Synonyms UBC7
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC118048 sequence for NM_003343 edited (data generated by NextGen Sequencing)
ATGGCGGGGACCGCGCTCAAGAGGCTGATGGCCGAGTACAAACAATTAACACTGAATCCT
CCGGAAGGAATTGTAGCAGGCCCCATGAATGAAGAGAACTTTTTTGAATGGGAGGCATTG
ATCATGGGCCCAGAAGACACCTGCTTTGAGTTTGGTGTTTTTCCTGCCATCCTGAGTTTC
CCACTTGATTACCCGTTAAGTCCCCCAAAGATGAGATTTACCTGTGAGATGTTTCATCCC
AACATCTACCCTGATGGGAGAGTCTGCATTTCCATCCTCCACGCGCCAGGCGATGACCCC
ATGGGCTACGAGAGCAGCGCGGAGCGGTGGAGTCCTGTGCAGAGTGTGGAGAAGATCCTG
CTGTCGGTGGTGAGCATGCTGGCAGAGCCCAATGACGAAAGTGGAGCTAACGTGGATGCG
TCCAAAATGTGGCGCGATGACCGGGAGCAGTTCTATAAGATTGCCAAGCAGATCGTCCAG
AAGTCTCTGGGACTGTGA

Clone variation with respect to NM_003343.5
5' Read Nucleotide Sequence
>OriGene 5' read for NM_003343 unedited
GGTTCAAAATTGTATACGACTCCTATAGGCGGCCGCGCAATTCGCACGAGGCTCGGCGCA
GCTGTTGCGGGGCCATGGCGGGGACCGCGCTCAAGAGGCTGATGGCCGAGTACAAACAAT
TAACACTGAATCCTCCGGAAGGAATTGTAGCAGGCCCCATGAATGAAGAGAACTTTTTTG
AATGGGAGGCATTGATCATGGGCCCAGAAGACACCTGCTTTGAGTTTGGTGTTTTTCCTG
CCATCCTGAGTTTCCCACTTGATTACCCGTTAAGTCCCCCAAAGATGAGATTTACCTGTG
AGATGTTTCATCCCAACATCTACCCTGATGGGAGAGTCTGCATTTCCATCCTCCACGCGC
CAGGCGATGACCCCATGGGCTACGAGAGCAGCGCGGAGCGGTGGAGTCCTGTGCAGAGTG
TGGAGAAGATCCTGCTGTCGGTGGTGAGCATGCTGGCAGAGCCCAATGACGAAAGTGGAG
CTAACGTGGATGCGTCCAAAATGTGGCGCGATGACCGGGAGCAGTTCTATAAGATTGCCA
AGCAGATCGTCCAGAAGTCTCTGGGACTGTGAGACCTGGCCTCGCACAGGCGCGCACACA
CCGCCAAGCAGCTCAGCATTCTCCCCCGGCACACTTAGTGACAGTGATGCTCTGTGCTGG
TACCAAACAAGGCAGACTTGCAAGAACCATGGCATCTTTTTTTTTTTTCAAACCTTTCCT
ACTTCAAACAGGCTTCTCTTCTGAAATGATGACTTAATGTCGAATATTGACAGCTTACTG
CAGTTTTACAGTATTCCTCACAAAGGGCTTCAGGTAGATTATCAGAGCTGTTAGCACTAC
CTCTNCCCGCTGAAACCAGCAGTTCATGGCCTTCTGTGGATTTCCTCCTTCCTGNAGTGT
GAAGGGGGTT
Restriction Sites NotI-NotI
ACCN NM_003343
Insert Size 3730 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_003343.4, NP_003334.2
RefSeq Size 2919 bp
RefSeq ORF 498 bp
Locus ID 7327
UniProt ID P60604
Cytogenetics 21q22.3
Domains UBCc
Protein Families Druggable Genome
Protein Pathways Parkinson's disease, Ubiquitin mediated proteolysis
Summary The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. The encoded protein shares 100% sequence identity with the mouse counterpart. This gene is ubiquitously expressed, with high expression seen in adult muscle. Three alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
Transcript Variant: This variant (1) encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:UBE2G2 (NM_003343) Human Untagged Clone
Your Rating
SKU Description Size Price
RC200407 UBE2G2 (Myc-DDK-tagged)-Human ubiquitin-conjugating enzyme E2G 2 (UBE2G2), transcript variant 1 10 ug
$150.00
RC200407L1 Lenti ORF clone of Human ubiquitin-conjugating enzyme E2G 2 (UBE2G2), transcript variant 1, Myc-DDK-tagged 10 ug
$450.00
RC200407L2 Lenti ORF clone of Human ubiquitin-conjugating enzyme E2G 2 (UBE2G2), transcript variant 1, mGFP tagged 10 ug
$450.00
RC200407L3 Lenti ORF clone of Human ubiquitin-conjugating enzyme E2G 2 (UBE2G2), transcript variant 1, Myc-DDK-tagged 10 ug
$450.00
RC200407L4 Lenti ORF clone of Human ubiquitin-conjugating enzyme E2G 2 (UBE2G2), transcript variant 1, mGFP tagged 10 ug
$450.00
RG200407 UBE2G2 (tGFP-tagged) - Human ubiquitin-conjugating enzyme E2G 2 (UBE2G2), transcript variant 1 10 ug
$489.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.