BANF1 (NM_003860) Human Untagged Clone

SKU
SC117722
BANF1 (untagged)-Human barrier to autointegration factor 1 (BANF1), transcript variant 1
$150.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol BANF1
Synonyms BAF; BCRP1; D14S1460; NGPS
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_003860 edited
ATGACAACCTCCCAAAAGCACCGAGACTTCGTGGCAGAGCCCATGGGGGAGAAGCCAGTG
GGGAGCCTGGCTGGGATTGGTGAAGTCCTGGGCAAGAAGCTGGAGGAAAGGGGTTTTGAC
AAGGCCTATGTTGTCCTTGGCCAGTTTCTGGTGCTAAAGAAAGATGAAGACCTCTTCCGG
GAATGGCTGAAAGACACTTGTGGCGCCAACGCCAAGCAGTCCCGGGACTGCTTCGGATGC
CTTCGAGAGTGGTGCGACGCCTTCTTGTGA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_003860 unedited
CACGAGGGCCGGGTGGCGGGAGGAACCGTTACGGGAACTGAAGTTGCGGATTAAGCCTGA
TCAAGATGACAACCTCCCAAAAGCACCGAGACTTCGTGGCAGAGCCCATGGGGGAGAAGC
CAGTGGGGAGCCTGGCTGGGATTGGTGAAGTCCTGGGCAAGAAGCTGGAGGAAAGGGGTT
TTGACAAGGCCTATGTTGTCCTTGGCCAGTTTCTGGTGCTAAAGAAAGATGAAGACCTCT
TCCGGGAATGGCTGAAAGACACTTGTGGCGCCAACGCCAAGCAGTCCCGGGACTGCTTCG
GATGCCTTCGAGAGTGGTGCGACGCCTTCTTGTGATGCTCTCTGGGAAGCTCTCAATCCC
CAGCCCTCATCCAGAGTTTGCAGCCGAGTAGGGACTCCTCCCCTGTCCTCTACGAAGGAA
AAGATTGCTATTGTCGTACTCACCTCCGACGTACTCCGGGGTCTTTTGGGAGTTTTCTCC
CCTAACCATTTCAACTTTTTTTTGGATTCTCGCTCTTGCATGCCTCCCCCGTCCTTTTTC
CCTTGCCAGTTCCCTGGTGACAGTTACCAGCTTTCCTGAATGGATTCCCGGCCCCATCCC
TCACCCCCACCCTCACTTTCAATCCGTTTGATACCATTTGGCTCCTTTTTTGGCAGAACA
GTCACTGTCCTTGTAAAGTTTTTTAGATCAATAAAGTCAGTGGCTTTCN
Restriction Sites NotI-NotI
ACCN NM_003860
Insert Size 2500 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_003860.2, NP_003851.1
RefSeq Size 1192 bp
RefSeq ORF 270 bp
Locus ID 8815
UniProt ID O75531
Cytogenetics 11q13.1
Summary The protein encoded by this gene was first identified by its ability to protect retroviruses from intramolecular integration and therefore promote intermolecular integration into the host cell genome. The protein forms a homodimer which localizes to both the nucleus and cytoplasm and is specifically associated with chromosomes during mitosis. This protein binds to double stranded DNA in a non-specific manner and also binds to LEM-domain containing proteins of the nuclear envelope. This protein is thought to facilitate nuclear reassembly by binding with both DNA and inner nuclear membrane proteins and thereby recruit chromatin to the nuclear periphery. Alternative splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, Jan 2009]
Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein.
Write Your Own Review
You're reviewing:BANF1 (NM_003860) Human Untagged Clone
Your Rating
SKU Description Size Price
RC203270 BANF1 (Myc-DDK-tagged)-Human barrier to autointegration factor 1 (BANF1), transcript variant 1 10 ug
$150.00
RC203270L1 Lenti ORF clone of Human barrier to autointegration factor 1 (BANF1), transcript variant 1, Myc-DDK-tagged 10 ug
$450.00
RC203270L2 Lenti ORF clone of Human barrier to autointegration factor 1 (BANF1), transcript variant 1, mGFP tagged 10 ug
$450.00
RC203270L3 Lenti ORF clone of Human barrier to autointegration factor 1 (BANF1), transcript variant 1, Myc-DDK-tagged 10 ug
$450.00
RC203270L4 Lenti ORF clone of Human barrier to autointegration factor 1 (BANF1), transcript variant 1, mGFP tagged 10 ug
$450.00
RG203270 BANF1 (tGFP-tagged) - Human barrier to autointegration factor 1 (BANF1), transcript variant 1 10 ug
$489.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.