COX11 (NM_004375) Human Untagged Clone
SKU
SC117421
COX11 (untagged)-Human COX11 cytochrome c oxidase assembly homolog (yeast) (COX11), nuclear gene encoding mitochondrial protein, transcript variant 1
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | COX11 |
Synonyms | COX11P |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
Fully Sequenced ORF
>NCBI ORF sequence for NM_004375, the custom clone sequence may differ by one or more nucleotides
ATGGGAGGGCTCTGGCGTCCTGGATGGAGGTGCGTTCCTTTCTGTGGCTGGCGCTGGATCCACCCTGGGT CTCCAACCAGGGCTGCAGAGAGGGTAGAGCCGTTTCTTAGGCCAGAGTGGAGTGGGACAGGAGGTGCCGA GAGAGGACTGAGGTGGCTTGGGACATGGAAGCGCTGCAGCCTTCGAGCCCGGCATCCAGCATTGCAGCCG CCGCGGCGGCCTAAGAGCTCGAACCCTTTCACACGCGCGCAGGAGGAGGAGCGGCGGCGGCAGAACAAGA CGACCCTCACTTACGTGGCCGCTGTCGCCGTGGGCATGCTGGGGGCGTCCTACGCTGCCGTACCCCTTTA TCGGCTCTATTGCCAGACTACTGGACTTGGAGGATCAGCAGTTGCAGGTCATGCCTCAGACAAGATTGAA AACATGGTGCCTGTTAAAGATCGAATCATTAAAATTAGCTTTAATGCAGATGTGCATGCAAGTCTCCAGT GGAACTTTAGACCTCAGCAAACAGAAATATATGTGGTGCCAGGAGAGACTGCACTGGCGTTTTACAGAGC TAAGAATCCTACTGACAAACCAGTAATTGGAATTTCTACATACAATATTGTTCCATTTGAAGCTGGACAG TATTTCAATAAAATACAGTGCTTCTGTTTTGAAGAACAAAGGCTTAATCCCCAAGAGGAAGTAGATATGC CAGTGTTTTTCTACATTGATCCTGAATTTGCTGAAGATCCAAGAATGATTAAAGTTGATCTTATCACTCT TTCTTACACTTTTTTTGAAGCAAAGGAAGGGCACAAGTTGCCAGTTCCAGGATATAATTGA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_004375 unedited
NGGTCGAATTTGTATACGACTCCTATAGGCGGCNCGCGATCGGCACGAGGGTTAGTTCAG AGGGTTATGGGAGGGCTCTGGCGTCCTGGATGGAGGTGCGTTCCTTTCTGTGGCTGGCGC TGGATCCACCCTGGGTCTCCAACCAGGGCTGCAGAGAGGGTAGAGCCGTTTCTTAGGCCA GAGTGGAGTGGGACAGGAGGTGCCGAGAGAGGACTGAGGTGGCTTGGGACATGGAAGCGC TGCAGCCTTCGAGCCCGGCATCCAGCATTGCAGCCGCCGCGGCGGCCTAAGAGCTCGAAC CCTTTCACACGCGCGCAGGAGGAGGAGCGGCGGCGGCAGAACAAGACGACCCTCACTTAC GTGGCCGCTGTCGCCGTGGGCATGCTGGGGGCGTCCTACGCTGCCGTACCCCTTTATCGG CTCTATTGCCAGACTACTGGACTTGGAGGATCAGCAGTTGCAGGTCATGCCTCAGACAAG ATTGAAAACATGGTGCCTGTTAAAGATCGAATCATTAAAATTAGCTTTAATGCAGATGTG CATGCAAGTCTCCAGTGGAACTTTAGACCTCAGCAAACAGAAATATATGTGGTGCCAGGA GAGACTGCACTGGCGTTTTACAGAGCTAAGAATCCTACTGACAAACCAGTAATTGGAATT TCTACATACAATATTGTTCCATTTGAAGCTGGACAGTATTTCAATAAAATACAGGTACAT CAAAGTGTAAACTTTACAGAATATGANTAAGATACATGANACGGTTTAGTATGANACTTA AGTGTTTTAGTAGAATCTTGTGATTTCTGAAAACGAAATTCTTTCTAACATCAGCTATTN TTCTTCACTATCTATACCTGCTATGCAGAGATGGGAACCANACCAATGGATATCTGCTTT TAAGATAGAATTTA |
Restriction Sites | NotI-NotI |
ACCN | NM_004375 |
Insert Size | 3390 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_004375.2, NP_004366.1 |
RefSeq Size | 2717 bp |
RefSeq ORF | 831 bp |
Locus ID | 1353 |
UniProt ID | Q9Y6N1 |
Cytogenetics | 17q22 |
Domains | CtaG_Cox11 |
Protein Families | Transmembrane |
Protein Pathways | Metabolic pathways, Oxidative phosphorylation |
Summary | Cytochrome c oxidase (COX), the terminal component of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. This component is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes a protein which is not a structural subunit, but may be a heme A biosynthetic enzyme involved in COX formation, according to the yeast mutant studies. However, the studies in Rhodobacter sphaeroides suggest that this gene is not required for heme A biosynthesis, but required for stable formation of the Cu(B) and magnesium centers of COX. This human protein is predicted to contain a transmembrane domain localized in the mitochondrial inner membrane. Multiple transcript variants encoding different isoforms have been found for this gene. A related pseudogene has been found on chromosome 6. [provided by RefSeq, Jun 2009] Transcript Variant: This variant (1) encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC203238 | COX11 (Myc-DDK-tagged)-Human COX11 cytochrome c oxidase assembly homolog (yeast) (COX11), nuclear gene encoding mitochondrial protein, transcript variant 1 | 10 ug |
$300.00
|
|
RC203238L1 | Lenti ORF clone of Human COX11 cytochrome c oxidase assembly homolog (yeast) (COX11), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged | 10 ug |
$600.00
|
|
RC203238L2 | Lenti ORF clone of Human COX11 cytochrome c oxidase assembly homolog (yeast) (COX11), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged | 10 ug |
$600.00
|
|
RC203238L3 | Lenti ORF clone of Human COX11 cytochrome c oxidase assembly homolog (yeast) (COX11), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged | 10 ug |
$600.00
|
|
RC203238L4 | Lenti ORF clone of Human COX11 cytochrome c oxidase assembly homolog (yeast) (COX11), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged | 10 ug |
$600.00
|
|
RG203238 | COX11 (tGFP-tagged) - Human COX11 cytochrome c oxidase assembly homolog (yeast) (COX11), nuclear gene encoding mitochondrial protein, transcript variant 1 | 10 ug |
$489.00
MSRP
$500.00
MSRP
$500.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.