CREB1 (NM_004379) Human Untagged Clone

CAT#: SC117388

Reviews ()
Write a review

CREB1 (untagged)-Human cAMP responsive element binding protein 1 (CREB1), transcript variant A



Reconstitution Protocol

USD 300.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CREB1
Synonyms CREB; CREB-1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC117388 sequence for NM_004379 edited (data generated by NextGen Sequencing)
ATGACCATGGAATCTGGAGCCGAGAACCAGCAGAGTGGAGATGCAGCTGTAACAGAAGCT
GAAAACCAACAAATGACAGTTCAAGCCCAGCCACAGATTGCCACATTAGCCCAGGTATCT
ATGCCAGCAGCTCATGCAACATCATCTGCTCCCACCGTAACTCTAGTACAGCTGCCCAAT
GGGCAGACAGTTCAAGTCCATGGAGTCATTCAGGCGGCCCAGCCATCAGTTATTCAGTCT
CCACAAGTCCAAACAGTTCAGATTTCAACTATTGCAGAAAGTGAAGATTCACAGGAGTCA
GTGGATAGTGTAACTGATTCCCAAAAGCGAAGGGAAATTCTTTCAAGGAGGCCTTCCTAC
AGGAAAATTTTGAATGACTTATCTTCTGATGCACCAGGAGTGCCAAGGATTGAAGAAGAG
AAGTCTGAAGAGGAGACTTCAGCACCTGCCATCACCACTGTAACGGTGCCAACTCCAATT
TACCAAACTAGCAGTGGACAGTATATTGCCATTACCCAGGGAGGAGCAATACAGCTGGCT
AACAATGGTACCGATGGGGTACAGGGCCTGCAAACATTAACCATGACCAATGCAGCAGCC
ACTCAGCCGGGTACTACCATTCTACAGTATGCACAGACCACTGATGGACAGCAGATCTTA
GTGCCCAGCAACCAAGTTGTTGTTCAAGCTGCCTCTGGAGACGTACAAACATACCAGATT
CGCACAGCACCCACTAGCACTATTGCCCCTGGAGTTGTTATGGCATCCTCCCCAGCACTT
CCTACACAGCCTGCTGAAGAAGCAGCACGAAAGAGAGAGGTCCGTCTAATGAAGAACAGG
GAAGCAGCTCGAGAGTGTCGTAGAAAGAAGAAAGAATATGTGAAATGTTTAGAAAACAGA
GTGGCAGTGCTTGAAAATCAAAACAAGACATTGATTGAGGAGCTAAAAGCACTTAAGGAC
CTTTACTGCCACAAATCAGATTAA

Clone variation with respect to NM_004379.3
>OriGene 5' read for NM_004379 unedited
GGTCACATTTGTATACGACTCATATAGGGCGGCCGCGAATTCGCACGAGGCCTCAGTCGG
CGGCGGCTGCTGCTGCCTGTGGCCCGGGCGGCTGGGAGAAGCGGAGTGTTGGTGAGTGAC
GCGGCGGAGGTGTAGTTTGACGCGGTGTGTTACGTGGGGGAGAGAATAAAACTCCAGCGA
GATCCGGGCCGTGAACGAAAGCAGTGACGGAGGAGCTTGTACCACCGGTAACTAAATGAC
CATGGAATCTGGAGCCGAGAACCAGCAGAGTGGAGATGCAGCTGTAACAGAAGCTGAAAA
CCAACAAATGACAGTTCAAGCCCAGCCACAGATTGCCACATTAGCCCAGGTATCTATGCC
AGCAGCTCATGCAACATCATCTGCTCCCACCGTAACTCTAGTACAGCTGCCCAATGGGCA
GACAGTTCAAGTCCATGGAGTCATTCAGGCGGCCCAGCCATCAGTTATTCAGTCTCCACA
AGTCCAAACAGTTCAGATTTCAACTATTGCAGAAAGTGAAGATTCACAGGAGTCAGTGGA
TAGTGTAACTGATTCCCAAAAGCGAAGGGAAATTCTTTCAAGGAGGCCTTCCTACAGGAA
AATTTTGAATGACTTATCTTCTGATGCACCAGGAGTGCCAAGGATTGAAGAAGAGAAGTC
TGAAGAGGAGACTTCAGCACCTGCCATCACCACTGTAACGGTGCCAACTCCAATTTACCA
NACTAGCAGTGGACAGTATATTGCCATTACCCAGGGGAGGAGCATACAGCTGGCTAACAA
TGGTACCGATGGGGTACAGGGCCCTGCAACATTAACCATGACCAATGCAGCAGCCACTCA
GCCGGGTACTACCATTCTACAGTATGCACAGACCACTGATGGACAGCAGATCTTAATGCC
CAGCACCCAGTTGT
>OriGene 3' read for NM_004379 unedited
CTATGAACGCGGCCGCAATCTANAATCGAGTTTTTTTTTTTTTTTTTTAAGATAACTGTT
AGATTTATCGAGCTTAGTGAATAAAATGAGTAACAATTAAAAGTGGTATTGAAAACAATG
TATGATATACACAAATACAGACTGTTTTAATCAGGAATTAAAATTATAAAATGACAAAGG
CTATACAGCATATTGGAAAGCTAAAGCAGAACTAATAACTACTCTTTTTACAAGAGAACA
AAAAAATGTTTTGTAAGAATGACAATCCAAATATTGCAGTACAGCAGTCATTCAAATATG
TCTGAAAATAACTTTCCTTGTGCACATCTAACACTGTACTTTTTATATCCTTACAACTTC
TTTCATTTAAAAAATTCACTAGAGATTCTCTGTTAAATTGTTAATATGGAAAATATTTAA
AATCAGTATTTTTCTACATGTAACATTTCATAAACAAATATATATCACTTTGCTTTATTT
GACATCTTGAAGGCTTTCTTGGTGGTGGTATGTAAGTGCAATGGGCAACAGTAAATTAGA
AATATCTTTTTACGTAAATGAGTGACAATATAAATATTTTTGAAGGTGAGGACAATAACA
TTTATTTAAAAATCTTGTTATATAACTCAAGGGATTGGTTTACTGATCAGCATTTTACTA
AGAATTTAGTACTAACTAAAATATGCTNTGTACTTTTATTTACTTTGCTTTAATTTAAAA
TTCAAATACCATGCTTTGTCGTTCAGTTGGTTACTTCTTTTAATGTATTCAAAAATGTTG
AACACATACAGAACTGAATAAAAAGCACAACTGCCCTATGGAAGAGCTGTATTAGTACAG
AATGCTTTTAAGAACCAAGGACANATTNTCAGTNNTGNAGAAGACAACTACATAAAAGCC
CTCAATTCATTCTAATCCTTCATACATGCTAAAGTCTTTTAGAGGGATGTCTTAACAACT
TACTATTCCATGAGAGGGACACAGTCATTG
Restriction Sites NotI-NotI     
ACCN NM_004379
Insert Size 2690 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_004379.2, NP_004370.1
RefSeq Size 2964 bp
RefSeq ORF 984 bp
Locus ID 1385
UniProt ID P16220
Cytogenetics 2q33.3
Domains pKID, BRLZ
Protein Families Druggable Genome, Transcription Factors
Protein Pathways Antigen processing and presentation, Huntington's disease, Melanogenesis, Prostate cancer
Gene Summary This gene encodes a transcription factor that is a member of the leucine zipper family of DNA binding proteins. This protein binds as a homodimer to the cAMP-responsive element, an octameric palindrome. The protein is phosphorylated by several protein kinases, and induces transcription of genes in response to hormonal stimulation of the cAMP pathway. Alternate splicing of this gene results in several transcript variants encoding different isoforms. [provided by RefSeq, Mar 2016]
Transcript Variant: This variant (1, also known as A) lacks an alternate in-frame exon compared to variant 2. The resulting isoform (A) has the same N- and C-termini but is shorter compared to isoform B. Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
Other products for "CREB1"
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.