GNG4 (NM_004485) Human Untagged Clone

SKU
SC117334
GNG4 (untagged)-Human guanine nucleotide binding protein (G protein), gamma 4 (GNG4), transcript variant 3
$150.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol GNG4
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC117334 sequence for NM_004485 edited (data generated by NextGen Sequencing)
ATGAAAGAGGGCATGTCTAATAACAGCACCACTAGCATCTCCCAAGCCAGGAAAGCTGTG
GAGCAGCTAAAGATGGAAGCCTGTATGGACAGGGTCAAGGTCTCCCAGGCAGCCGCGGAC
CTCCTGGCCTACTGTGAAGCTCACGTGCGGGAAGATCCTCTCATCATTCCAGTGCCTGCA
TCAGAAAACCCCTTTCGCGAGAAGAAGTTCTTTTGTACCATTCTCTAA

Clone variation with respect to NM_004485.3
114 t=>c
5' Read Nucleotide Sequence
>OriGene 5' read for NM_004485 unedited
NTTGTTCAAATTTTGTNATACGACTCACTTATAGGGCGGCCGCGAATTCGCACGAGCCGC
GCTGCAGACGAAGCCCGCGCGTGATCCCGCTCCGGGTGACCTCAAAGCAGAAGCTCTGAA
TTCACCTCTCATCTGACGACTGACAGCTGCTGCCACCGCCAGCCTCTGTCCCTTGCCCAG
GCCTGTCACACGGCTGCCTCTCAGCAGGGGCAGTAGAATGAAAGAGGGCATGTCTAATAA
CAGCACCACTAGCATCTCCCAAGCCAGGAAAGCTGTGGAGCAGCTAAAGATGGAAGCCTG
TATGGACAGGGTCAAGGTCTCCCAGGCAGCCGCGGACCTCCTGGCCTACTGTGAAGCTCA
CGTGCGGGAAGATCCTCTCATCATTCCAGTGCCTGCATCAGAAAACCCCTTTCGCGAGAA
GAAGTTCTTTTGTACCATTCTCTAACTCCGTGTGTGATGAAAACGCCTCCTTTTCTGACC
TTCAAAGTCCCCTGTAGAGACCATGCATGCTCTAAGCCTTAGGGAGTGAGACCAACACCC
ATCCCTGCCCAGCCAACAGTGGCCGGGGCTTGTCTTATGTTTCCATCTGTTTTCTTCGTG
GCATTCAATTTCATTTTTTTCCTTTTCATTTTCATGTTATTCTCATTATTGGCAAAGAAA
ATCAAAATGTTTATAGCCAAATAACAAATGTGCCATGTAAAAGTAAGTCCTGGACTTAAG
AGTTTAAAATTTTTAAACATCAGTCTTCCAAGTTATATCATATTAATACATTTCAGTGGA
TAATTTATTTAAAAAAAAAACTATGCCTACATATCCCTTATTTGTATAATTAGTATCAAA
TTAGACATTTTGACCAACTGAAACTATAACGTTTCATCTCCTTTCCTGAAAAGACCTGCA
GAGTTCCGCATTCCTGCATTCCCTCACCTACAAAAA
Restriction Sites NotI-NotI
ACCN NM_004485
Insert Size 4690 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_004485.2, NP_004476.1
RefSeq Size 1734 bp
RefSeq ORF 228 bp
Locus ID 2786
UniProt ID P50150
Cytogenetics 1q42.3
Protein Families Druggable Genome
Protein Pathways Chemokine signaling pathway
Summary Guanine nucleotide-binding proteins (G proteins) are involved as a modulator or transducer in various transmembrane signaling systems. The beta and gamma chains are required for the GTPase activity, for replacement of GDP by GTP, and for G protein-effector interaction.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 3 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.
Write Your Own Review
You're reviewing:GNG4 (NM_004485) Human Untagged Clone
Your Rating
SKU Description Size Price
RC205299 GNG4 (Myc-DDK-tagged)-Human guanine nucleotide binding protein (G protein), gamma 4 (GNG4), transcript variant 3 10 ug
$150.00
RC205299L1 Lenti ORF clone of Human guanine nucleotide binding protein (G protein), gamma 4 (GNG4), transcript variant 3, Myc-DDK-tagged 10 ug
$450.00
RC205299L2 Lenti ORF clone of Human guanine nucleotide binding protein (G protein), gamma 4 (GNG4), transcript variant 3, mGFP tagged 10 ug
$450.00
RC205299L3 Lenti ORF clone of Human guanine nucleotide binding protein (G protein), gamma 4 (GNG4), transcript variant 3, Myc-DDK-tagged 10 ug
$450.00
RC205299L4 Lenti ORF clone of Human guanine nucleotide binding protein (G protein), gamma 4 (GNG4), transcript variant 3, mGFP tagged 10 ug
$450.00
RG205299 GNG4 (tGFP-tagged) - Human guanine nucleotide binding protein (G protein), gamma 4 (GNG4), transcript variant 3 10 ug
$489.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.