Cystatin A (CSTA) (NM_005213) Human Untagged Clone

SKU
SC116847
CSTA (untagged)-Human cystatin A (stefin A) (CSTA)
$150.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Cystatin A
Synonyms AREI; PSS4; STF1; STFA
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_005213 edited
ATGATACCTGGAGGCTTATCTGAGGCCAAACCCGCCACTCCAGAAATCCAGGAGATTGTT
GATAAGGTTAAACCACAGCTTGAAGAAAAAACAAATGAGACTTATGGAAAATTGGAAGCT
GTGCAGTATAAAACTCAAGTTGTTGCTGGAACAAATTACTACATTAAGGTACGAGCAGGT
GATAATAAATATATGCACTTGAAAGTATTCAAAAGTCTTCCCGGACAAAATGAGGACTTG
GTACTTACTGGATACCAGGTTGACAAAAACAAGGATGACGAGCTGACGGGCTTTTAG
5' Read Nucleotide Sequence
>OriGene 5' read for NM_005213 unedited
GCACGTCAAATTTTGTATACGACTCATATAGGGCGGCCGCGAATTCGCACGAGCAAAGAA
GCAATCAGCCAAAATGATACCTGGAGGCTTATCTGAGGCCAAACCCGCCACTCCAGAAAT
CCAGGAGATTGTTGATAAGGTTAAACCACAGCTTGAAGAAAAAACAAATGAGACTTATGG
AAAATTGGAAGCTGTGCAGTATAAAACTCAAGTTGTTGCTGGAACAAATTACTACATTAA
GGTACGAGCAGGTGATAATAAATATATGCACTTGAAAGTATTCAAAAGTCTTCCCGGACA
AAATGAGGACTTGGTACTTACTGGATACCAGGTTGACAAAAACAAGGATGACGAGCTGAC
GGGCTTTTAGCAGCATGTACCCAAAGTGTTCTGATTCCTTCAACTGGCTACTGAGTCATG
ATCCTTGCTGATAAATATAACCATCAATAAAGAAGCATTCTTTTCCAAAGAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAACTAAACTCTAAAATTGCGGCCGCGGACATAAAATGTT
ACCTGAACANATCCCGGGTGTCCTCCTTGTGACCCGGCCCCAGTGTTTATCTTGTCCCTG
AAAATTCCGGTGGGGTTCCCAGGAGCCTTTTCCCAGGACCTTTAAGTGGCCTGAAATTGG
CAAACTAGGTGCCCCCCAATATTTTTATAAAAAAATATGGGGGCGGTATATTGCCCCGCC
AAAGTCCTTTATAAAAATGTGGGGCCTGAAGGGGGCTATTTTTACCAAGGGTGCAATTTG
GGAACACATCCTTGGGTGCCTGGGGGGTCATTTTGGAAACCAAATGGGAATTTTGGGCCC
AAATCTTGCCCACTGAAGGGACCCACGCGGGGTTAAGCAAACTTCTTGATTAAAGTT
Restriction Sites NotI-NotI
ACCN NM_005213
Insert Size 500 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_005213.3, NP_005204.1
RefSeq Size 838 bp
RefSeq ORF 297 bp
Locus ID 1475
UniProt ID P01040
Cytogenetics 3q21.1
Domains CY
Summary The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins, and kininogens. This gene encodes a stefin that functions as a cysteine protease inhibitor, forming tight complexes with papain and the cathepsins B, H, and L. The protein is one of the precursor proteins of cornified cell envelope in keratinocytes and plays a role in epidermal development and maintenance. Stefins have been proposed as prognostic and diagnostic tools for cancer. [provided by RefSeq, Jul 2008]
Write Your Own Review
You're reviewing:Cystatin A (CSTA) (NM_005213) Human Untagged Clone
Your Rating
SKU Description Size Price
RC203115 CSTA (Myc-DDK-tagged)-Human cystatin A (stefin A) (CSTA) 10 ug
$150.00
RC203115L1 Lenti ORF clone of Human cystatin A (stefin A) (CSTA), Myc-DDK-tagged 10 ug
$450.00
RC203115L2 Lenti ORF clone of Human cystatin A (stefin A) (CSTA), mGFP tagged 10 ug
$450.00
RC203115L3 Lenti ORF clone of Human cystatin A (stefin A) (CSTA), Myc-DDK-tagged 10 ug
$450.00
RC203115L4 Lenti ORF clone of Human cystatin A (stefin A) (CSTA), mGFP tagged 10 ug
$450.00
RG203115 CSTA (tGFP-tagged) - Human cystatin A (stefin A) (CSTA) 10 ug
$489.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.