Cystatin A (CSTA) (NM_005213) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | Cystatin A |
Synonyms | AREI; PSS4; STF1; STFA |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
Fully Sequenced ORF
>OriGene ORF sequence for NM_005213 edited
ATGATACCTGGAGGCTTATCTGAGGCCAAACCCGCCACTCCAGAAATCCAGGAGATTGTT GATAAGGTTAAACCACAGCTTGAAGAAAAAACAAATGAGACTTATGGAAAATTGGAAGCT GTGCAGTATAAAACTCAAGTTGTTGCTGGAACAAATTACTACATTAAGGTACGAGCAGGT GATAATAAATATATGCACTTGAAAGTATTCAAAAGTCTTCCCGGACAAAATGAGGACTTG GTACTTACTGGATACCAGGTTGACAAAAACAAGGATGACGAGCTGACGGGCTTTTAG
5' Read Nucleotide Sequence
>OriGene 5' read for NM_005213 unedited
GCACGTCAAATTTTGTATACGACTCATATAGGGCGGCCGCGAATTCGCACGAGCAAAGAA GCAATCAGCCAAAATGATACCTGGAGGCTTATCTGAGGCCAAACCCGCCACTCCAGAAAT CCAGGAGATTGTTGATAAGGTTAAACCACAGCTTGAAGAAAAAACAAATGAGACTTATGG AAAATTGGAAGCTGTGCAGTATAAAACTCAAGTTGTTGCTGGAACAAATTACTACATTAA GGTACGAGCAGGTGATAATAAATATATGCACTTGAAAGTATTCAAAAGTCTTCCCGGACA AAATGAGGACTTGGTACTTACTGGATACCAGGTTGACAAAAACAAGGATGACGAGCTGAC GGGCTTTTAGCAGCATGTACCCAAAGTGTTCTGATTCCTTCAACTGGCTACTGAGTCATG ATCCTTGCTGATAAATATAACCATCAATAAAGAAGCATTCTTTTCCAAAGAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAACTAAACTCTAAAATTGCGGCCGCGGACATAAAATGTT ACCTGAACANATCCCGGGTGTCCTCCTTGTGACCCGGCCCCAGTGTTTATCTTGTCCCTG AAAATTCCGGTGGGGTTCCCAGGAGCCTTTTCCCAGGACCTTTAAGTGGCCTGAAATTGG CAAACTAGGTGCCCCCCAATATTTTTATAAAAAAATATGGGGGCGGTATATTGCCCCGCC AAAGTCCTTTATAAAAATGTGGGGCCTGAAGGGGGCTATTTTTACCAAGGGTGCAATTTG GGAACACATCCTTGGGTGCCTGGGGGGTCATTTTGGAAACCAAATGGGAATTTTGGGCCC AAATCTTGCCCACTGAAGGGACCCACGCGGGGTTAAGCAAACTTCTTGATTAAAGTT |
Restriction Sites | NotI-NotI |
ACCN | NM_005213 |
Insert Size | 500 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_005213.3, NP_005204.1 |
RefSeq Size | 838 bp |
RefSeq ORF | 297 bp |
Locus ID | 1475 |
UniProt ID | P01040 |
Cytogenetics | 3q21.1 |
Domains | CY |
Summary | The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins, and kininogens. This gene encodes a stefin that functions as a cysteine protease inhibitor, forming tight complexes with papain and the cathepsins B, H, and L. The protein is one of the precursor proteins of cornified cell envelope in keratinocytes and plays a role in epidermal development and maintenance. Stefins have been proposed as prognostic and diagnostic tools for cancer. [provided by RefSeq, Jul 2008] |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC203115 | CSTA (Myc-DDK-tagged)-Human cystatin A (stefin A) (CSTA) | 10 ug |
$150.00
|
|
RC203115L1 | Lenti ORF clone of Human cystatin A (stefin A) (CSTA), Myc-DDK-tagged | 10 ug |
$450.00
|
|
RC203115L2 | Lenti ORF clone of Human cystatin A (stefin A) (CSTA), mGFP tagged | 10 ug |
$450.00
|
|
RC203115L3 | Lenti ORF clone of Human cystatin A (stefin A) (CSTA), Myc-DDK-tagged | 10 ug |
$450.00
|
|
RC203115L4 | Lenti ORF clone of Human cystatin A (stefin A) (CSTA), mGFP tagged | 10 ug |
$450.00
|
|
RG203115 | CSTA (tGFP-tagged) - Human cystatin A (stefin A) (CSTA) | 10 ug |
$489.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.