HIP2 (UBE2K) (NM_005339) Human Untagged Clone

SKU
SC116761
UBE2K (untagged)-Human ubiquitin-conjugating enzyme E2K (UBE2K), transcript variant 1
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol HIP2
Synonyms E2-25K; HIP2; HYPG; LIG; UBC1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_005339, the custom clone sequence may differ by one or more nucleotides


ATGGCCAACATCGCGGTGCAGCGAATCAAGCGGGAGTTCAAGGAGGTGCTGAAGAGCGAGGAGACGAGCA
AAAATCAAATTAAAGTAGATCTTGTAGATGAGAATTTTACAGAATTAAGAGGAGAAATAGCAGGACCTCC
AGACACACCATATGAAGGAGGAAGATACCAACTAGAGATAAAAATACCAGAAACATACCCATTTAATCCC
CCTAAGGTCCGGTTTATCACTAAAATATGGCATCCTAATATTAGTTCCGTCACAGGGGCTATTTGTTTGG
ATATCCTGAAAGATCAATGGGCAGCTGCAATGACTCTCCGCACGGTATTATTGTCATTGCAAGCACTATT
GGCAGCTGCAGAGCCAGATGATCCACAGGATGCTGTAGTAGCAAATCAGTACAAACAAAATCCCGAAATG
TTCAAACAGACAGCTCGACTTTGGGCACATGTGTATGCTGGAGCACCAGTTTCTAGTCCAGAATACACCA
AAAAAATAGAAAACCTATGTGCTATGGGCTTTGATAGGAATGCAGTAATAGTGGCCTTGTCTTCAAAATC
ATGGGATGTAGAGACTGCAACAGAATTGCTTCTGAGTAACTGA


5' Read Nucleotide Sequence
>OriGene 5' read for NM_005339 unedited
AGAGTCGATTATTGTATACGACTCACTATAGGCGGCCGCGNAATTCGCACGAGGGAGGAG
GCGGGTACGAATCAGCTGCGGGCGGAGACATGGCCAACATCGCGGTGCAGCGAATCAAGC
GGGAGTTCAAGGAGGTGCTGAAGAGCGAGGAGACGAGCAAAAATCAAATTAAAGTAGATC
TTGTAGATGAGAATTTTACAGAATTAAGAGGAGAAATAGCAGGACCTCCAGACACACCAT
ATGAAGGAGGAAGATACCAACTAGAGATAAAAATACCAGAAACATACCCATTTAATCCCC
CTAAGGTCCGGTTTATCACTAAAATATGGCATCCTAATATTAGTTCCGTCACAGGGGCTA
TTTGTTTGGATATCCTGAAAGATCAATGGGCAGCTGCAATGACTCTCCGCACGGTATTAT
TGTCATTGCAAGCACTATTGGCAGCTGCAGAGCCAGATGATCCACAGGATGCTGTAGTAG
CAAATCAGTACAAACAAAATCCCGAAATGTTCAAACAGACAGCTCGACTTTGGGCACATG
TGTATGCTGGAGCACCAGTTTCTAGTCCAGAATACACCAAAAAAATAGAAAACCTATGTG
CTATGGGCTTTGATAGGAATGCAGTAATAGTGGCCTTGTCTTCAAAATCATGGGATGTAG
AGACTGCAACAGAATTGCTTCTGAGTAACTGAGGCATAGAGAGCTGCTGATATAGTCAAG
CTTGCCTCTTCTTGAGGAGCACCAACATCTGTTATTTTTAGGATTCTGCATAGATTTCTT
TTTAACTGGCATTCTTGCCTAATGATGTTATCTAGGCACCATTGGAGACTGAAAAAAAAA
AATCCTGCTCTGTAAATAAGCTAATTAAACGTCTGTGTAAATTAAAAAAGGGGAATACTT
TAATTNTTTTTCTAATAGTGTAA
Restriction Sites NotI-NotI
ACCN NM_005339
Insert Size 4890 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_005339.3, NP_005330.1
RefSeq Size 2208 bp
RefSeq ORF 603 bp
Locus ID 3093
UniProt ID P61086
Cytogenetics 4p14
Domains UBA, UBCc
Protein Families Druggable Genome, Transcription Factors
Protein Pathways Ubiquitin mediated proteolysis
Summary The protein encoded by this gene belongs to the ubiquitin-conjugating enzyme family. This protein interacts with RING finger proteins, and it can ubiquitinate huntingtin, the gene product for Huntington's disease. Known functions for this protein include a role in aggregate formation of expanded polyglutamine proteins and the suppression of apoptosis in polyglutamine diseases, a role in the dislocation of newly synthesized MHC class I heavy chains from the endoplasmic reticulum, and involvement in foam cell formation. Multiple transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:HIP2 (UBE2K) (NM_005339) Human Untagged Clone
Your Rating
SKU Description Size Price
RC208645 UBE2K (Myc-DDK-tagged)-Human ubiquitin-conjugating enzyme E2K (UBE2K), transcript variant 1 10 ug
$300.00
RC208645L1 Lenti ORF clone of Human ubiquitin-conjugating enzyme E2K (UBE2K), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC208645L2 Lenti ORF clone of Human ubiquitin-conjugating enzyme E2K (UBE2K), transcript variant 1, mGFP tagged 10 ug
$600.00
RC208645L3 Lenti ORF clone of Human ubiquitin-conjugating enzyme E2K (UBE2K), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC208645L4 Lenti ORF clone of Human ubiquitin-conjugating enzyme E2K (UBE2K), transcript variant 1, mGFP tagged 10 ug
$600.00
RG208645 UBE2K (tGFP-tagged) - Human ubiquitin-conjugating enzyme E2K (UBE2K), transcript variant 1 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.