Nrf2 (NFE2L2) (NM_006164) Human Untagged Clone

CAT#: SC116283

Reviews ()
Write a review

NFE2L2 (untagged)-Human nuclear factor (erythroid-derived 2)-like 2 (NFE2L2), transcript variant 1



  "NM_006164" in other vectors (6)

Reconstitution Protocol

USD 564.00

In Stock*

Size
    • 10 ug

Product images

Other products for "NFE2L2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NFE2L2
Synonyms HEBP1; IMDDHH; Nrf-2; NRF2
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC116283 sequence for NM_006164 edited (data generated by NextGen Sequencing)
ATGATGGACTTGGAGCTGCCGCCGCCGGGACTCCCGTCCCAGCAGGACATGGATTTGATT
GACATACTTTGGAGGCAAGATATAGATCTTGGAGTAAGTCGAGAAGTATTTGACTTCAGT
CAGCGACGGAAAGAGTATGAGCTGGAAAAACAGAAAAAACTTGAAAAGGAAAGACAAGAA
CAACTCCAAAAGGAGCAAGAGAAAGCCTTTTTCGCTCAGTTACAACTAGATGAAGAGACA
GGTGAATTTCTCCCAATTCAGCCAGCCCAGCACATCCAGTCAGAAACCAGTGGATCTGCC
AACTACTCCCAGGTTGCCCACATTCCCAAATCAGATGCTTTGTACTTTGATGACTGCATG
CAGCTTTTGGCGCAGACATTCCCGTTTGTAGATGACAATGAGGTTTCTTCGGCTACGTTT
CAGTCACTTGTTCCTGATATTCCCGGTCACATCGAGAGCCCAGTCTTCATTGCTACTAAT
CAGGCTCAGTCACCTGAAACTTCTGTTGCTCAGGTAGCCCCTGTTGATTTAGACGGTATG
CAACAGGACATTGAGCAAGTTTGGGAGGAGCTATTATCCATTCCTGAGTTACAGTGTCTT
AATATTGAAAATGACAAGCTGGTTGAGACTACCATGGTTCCAAGTCCAGAAGCCAAACTG
ACAGAAGTTGACAATTATCATTTTTACTCATCTATACCCTCAATGGAAAAAGAAGTAGGT
AACTGTAGTCCACATTTTCTTAATGCTTTTGAGGATTCCTTCAGCAGCATCCTCTCCACA
GAAGACCCCAACCAGTTGACAGTGAACTCATTAAATTCAGATGCCACAGTCAACACAGAT
TTTGGTGATGAATTTTATTCTGCTTTCATAGCTGAGCCCAGTATCAGCAACAGCATGCCC
TCACCTGCTACTTTAAGCCATTCACTCTCTGAACTTCTAAATGGGCCCATTGATGTTTCT
GATCTATCACTTTGCAAAGCTTTCAACCAAAACCACCCTGAAAGCACAGCAGAATTCAAT
GATTCTGACTCCGGCATTTCACTAAACACAAGTCCCAGTGTGGCATCACCAGAACACTCA
GTGGAATCTTCCAGCTATGGAGACACACTACTTGGCCTCAGTGATTCTGAAGTGGAAGAG
CTAGATAGTGCCCCTGGAAGTGTCAAACAGAATGGTCCTAAAACACCAGTACATTCTTCT
GGGGATATGGTACAACCCTTGTCACCATCTCAGGGGCAGAGCACTCACGTGCATGATGCC
CAATGTGAGAACACACCAGAGAAAGAATTGCCTGTAAGTCCTGGTCATCGGAAAACCCCA
TTCACAAAAGACAAACATTCAAGCCGCTTGGAGGCTCATCTCACAAGAGATGAACTTAGG
GCAAAAGCTCTCCATATCCCATTCCCTGTAGAAAAAATCATTAACCTCCCTGTTGTTGAC
TTCAACGAAATGATGTCCAAAGAGCAGTTCAATGAAGCTCAACTTGCATTAATTCGGGAT
ATACGTAGGAGGGGTAAGAATAAAGTGGCTGCTCAGAATTGCAGAAAAAGAAAACTGGAA
AATATAGTAGAACTAGAGCAAGATTTAGATCATTTGAAAGATGAAAAAGAAAAATTGCTC
AAAGAAAAAGGAGAAAATGACAAAAGCCTTCACCTACTGAAAAAACAACTCAGCACCTTA
TATCTCGAAGTTTTCAGCATGCTACGTGATGAAGATGGAAAACCTTATTCTCCTAGTGAA
TACTCCCTGCAGCAAACAAGAGATGGCAATGTTTTCCTTGTTCCCAAAAGTAAGAAGCCA
GATGTTAAGAAAAACTAG

Clone variation with respect to NM_006164.3
>OriGene 5' read for NM_006164 unedited
ATTTTGTATACGACTCACTATAGGCGGCCGCGAATTCGGCACGAGGGGGAGCCCGGAGGA
GCCGCCGACGCAGCCGCCACCGCCGCCGCCGCCACCAGAGCCGCCCTGTCCGCGCCGCGC
CTCGGCAGCCGGAACAGGGCCGCCGTCGGGGAGCCCCAACACACGGTCCACAGCTCATCA
TGATGGACTTGGAGCTGCCGCCGCCGGGACTCCCGTCCCAGCAGGACATGGATTTGATTG
ACATACTTTGGAGGCAAGATATAGATCTTGGAGTAAGTCGAGAAGTATTTGACTTCAGTC
AGCGACGGAAAGAGTATGAGCTGGAAAAACAGAAAAAACTTGAAAAGGAAAGACAAGAAC
AACTCCAAAAGGAGCAAGAGAAAGCCTTTTTCGCTCAGTTACAACTAGATGAAGAGACAG
GTGAATTTCTCCCAATTCAGCCAGCCCAGCACATCCAGTCAGAAACCAGTGGATCTGCCA
ACTACTCCCAGGTTGCCCACATTCCCAAATCAGATGCTTTGTACTTTGATGACTGCATGC
AGCTTTTGGCGCAGACATTCCCGTTTGTAGATGACAATGAGGTTTCTTCGGCTACGTTTC
AGTCACTTGTTCCTGATATTCCCGGTCACATCGAGAGCCCAGTCTTCATTGCTACTAATC
AGGCTCAGTCACCTGAAACTTCTGTTGCTCAGGTAGCCCCTGTTGATTTAGACGGTATGC
AACAGGACATTGNAGCAGTTGGNGAGGAGCTATTATCCATTCCTGAGTTACAGTGTCTTA
ATATTGAAAATNGACAGCTGGTTGAGACTACCATGGTTNCNAGTCCAGAAGCCAAACTGA
CAGAAAGTGACANTNATCATTTTTACTCATCTATACCCCTCATGGGANAAGAAGTANNGT
ACTGTAGTCCACATTTTCTTATGCTTNTGAG
>OriGene 3' read for NM_006164 unedited
NNNCCCTTCTATGNNACCGCGGCCGCTATCTAGNATCGAGTTTTTTTTTTTTTTTTTTTT
TAACAGTCATAATAATCCTTTATTAGTACCAGCTCTTAAAATTTTTTTTTTTTGCCAGAG
CTAAACAATTTAATATAAAAAATGCCATTTTTTGTCCATACAGTATTTATAAAAAAGTAC
ATAGTGGTTAGTTTTGCAATAATTTCTTTTTAGCCAGATGTCATATCATCATATAAATCT
ATGAATATAACAAATGACATAAGAACAGTATAAATAAGTTTTTGTAGTATTTACACTTAC
ACAGAAACTAGCCCAAATGGTGTCCTAAGAAATTGTTTACAGTTAAAGTGAAACTACTGA
TTCAACATACTGACACTCCAATGCTTTTTAAAGTTTCGTATTATTTTCTATACTAGTTTT
GGCTATGATTTTGCATAGAATTACTTATAAAGTATGAGCATTTCACATCACAGTAGGAGC
TTTTAGTATATTAGTACAAAAAACTAGCTCAGAAAGGTCAAATCTCCCTAATCTAGTTTT
TCTAACATCTGGCTCCTACTTTGGGGACAGGAAAAACTTGCCTTTTTTGTTTGCTGCAGG
AGGTTTCCCTTAGGAAAAAAGGGTTCCCTCTTACTCAGGAACAGGCTGAAAATTCGAGAA
TAAGGGGCTGGTTGGTTTTTCCGGGGGGAAGGCTTTTGGAATTTTCCCTTTCTTTGGGGC
AATTTTTTTTTTACTTTAAAAAGGCCAAAAACGGGCCAAGGCCCCAAAATTTCCAGGTTT
CTTTTTTTGGGAATTGGAAGACCCTTTTTTTTTCCCCCCCCTCTTTTTCCAAATAAAGCA
AGGGGGGCTTTGGGACCGCTTTGGGCAAATATTTTGAAAAA
Restriction Sites NotI-NotI     
ACCN NM_006164
Insert Size 1818 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_006164.2, NP_006155.2
RefSeq Size 2439 bp
RefSeq ORF 1818 bp
Locus ID 4780
UniProt ID Q16236
Cytogenetics 2q31.2
Domains BRLZ
Protein Families Transcription Factors
Gene Summary This gene encodes a transcription factor which is a member of a small family of basic leucine zipper (bZIP) proteins. The encoded transcription factor regulates genes which contain antioxidant response elements (ARE) in their promoters; many of these genes encode proteins involved in response to injury and inflammation which includes the production of free radicals. Multiple transcript variants encoding different isoforms have been characterized for this gene. [provided by RefSeq, Sep 2015]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.