HBXIP (LAMTOR5) (NM_006402) Human Untagged Clone

SKU
SC116091
LAMTOR5 (untagged)-Human hepatitis B virus x interacting protein (HBXIP)
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol HBXIP
Synonyms HBXIP; XIP
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_006402, the custom clone sequence may differ by one or more nucleotides


ATGGAGCCAGGTGCAGGTCACCTCGACGGTCACCGCGCGGGGAGCCCAAGCCTTCGTCAGGCTCTGTGCG
ACGGAAGCGCAGTGATGTTTTCCAGTAAAGAACGCGGACGTTGCACCGTGATCAATTTTGTCCCTTTGGA
GGCGCCGTTACGGTCCACGCCCCGCTCGCGTCAAGTGACTGAGGCCTGTGGTGGAGAAGGACGTGCCGTG
CCGCTGGGTTCTGAGCCGGAGTGGTCGGTGGGTGGGATGGAGGCGACCTTGGAGCAGCACTTGGAAGACA
CAATGAAGAATCCCTCCATTGTTGGAGTCCTGTGCACAGATTCACAAGGACTTAATCTGGGTTGCCGCGG
GACCCTGTCAGATGAGCATGCTGGAGTGATATCTGTTCTAGCCCAGCAAGCAGCTAAGCTAACCTCTGAC
CCCACTGATATTCCTGTGGTGTGTCTAGAATCAGATAATGGGAACATTATGATCCAGAAACACGATGGCA
TCACGGTGGCAGTGCACAAAATGGCCTCTTGA


5' Read Nucleotide Sequence
>OriGene 5' read for NM_006402 unedited
GGCCGCGAATTCGGCACCAGCCGTGCCGCTGGGTTCTGAGCCGGAGTGGTCGGTGGGTGG
GATGGAGGCGACCTTGGAGCAGCACTTGGAAGACACAATGAAGAATCCCTCCATTGTTGG
AGTCCTGTGCACAGATTCACAAGGACTTAATCTGGGTTGCCGCGGGACCCTGTCAGATGA
GCATGCTGGAGTGATATCTGTTCTAGCCCAGCAAGCAGCTAAGCTAACCTCTGACCCCAC
TGATATTCCTGTGGTGTGTCTAGAATCAGATAATGGGAACATTATGATCCAGAAACACGA
TGGCATCACGGTGGCAGTGCACAAAATGGCCTCTTGATGCTCATATCTGTTCTTCAGCAG
CCTGTCATAGGAACTGGATCCTACCTATGTTAATTACCTTATAGAACTACTAAAGTTCCA
GTAGTTAGGCCATTCATTTAATGTGCATTAGGCACTTTTCTGTTTATTTAAGAGTCAATT
GCTTTCTAATGCTCTATGGACCGACTATCAAGATATTAGTAAGAAAGGATCATGTTTTGA
AGCAGCAGGTCCAGGTCACTTTGTATATAGAATTTTGCTGTATTCAATAAATCTGTTTGG
AGGAAAAAAAANNNAANANANNNNANNNNAANANNNAAANAAAAAAAAAAAAANAAAAAA
AAAAAAAAAANANAAAAAAAAAAAAAACCTCCCCTTTAAATGGGGCCGGGGTAAT
Restriction Sites NotI-NotI
ACCN NM_006402
Insert Size 870 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_006402.1, NP_006393.1
RefSeq Size 855 bp
RefSeq ORF 855 bp
Locus ID 10542
UniProt ID O43504
Cytogenetics 1p13.3
Summary This gene encodes a protein that specifically complexes with the C-terminus of hepatitis B virus X protein (HBx). The function of this protein is to negatively regulate HBx activity and thus to alter the replication life cycle of the virus. [provided by RefSeq, Jul 2008]
Write Your Own Review
You're reviewing:HBXIP (LAMTOR5) (NM_006402) Human Untagged Clone
Your Rating
SKU Description Size Price
RC209098 LAMTOR5 (Myc-DDK-tagged)-Human hepatitis B virus x interacting protein (HBXIP) 10 ug
$300.00
RC209098L1 Lenti ORF clone of Human hepatitis B virus x interacting protein (HBXIP), Myc-DDK-tagged 10 ug
$600.00
RC209098L2 Lenti ORF clone of Human hepatitis B virus x interacting protein (HBXIP), mGFP tagged 10 ug
$600.00
RC209098L3 Lenti ORF clone of Human hepatitis B virus x interacting protein (HBXIP), Myc-DDK-tagged 10 ug
$600.00
RC209098L4 Lenti ORF clone of Human hepatitis B virus x interacting protein (HBXIP), mGFP tagged 10 ug
$600.00
RG209098 LAMTOR5 (tGFP-tagged) - Human hepatitis B virus x interacting protein (HBXIP) 10 ug
$489.00 MSRP $500.00 MSRP $500.00
SC321903 LAMTOR5 (untagged)-Human hepatitis B virus x interacting protein (HBXIP) 10 ug
$300.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.