PRPF8 (NM_006445) Human Untagged Clone

CAT#: SC116070

Reviews ()
Write a review

PRPF8 (untagged)-Human PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae) (PRPF8)



  "NM_006445" in other vectors (3)

USD 2,265.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PRPF8
Synonyms HPRP8; PRP8; PRPC8; RP13; SNRNP220
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_006445, the custom clone sequence may differ by one or more nucleotides


ATGGCCGGAGTGTTTCCTTATCGAGGGCCGGGTAACCCGGTGCCTGGCCCTCTAGCCCCGCTACCGGACT
ACATGTCGGAGGAGAAGCTGCAGGAGAAAGCTCGAAAATGGCAGCAATTGCAGGCCAAGCGCTATGCAGA
AAAGCGGAAGTTTGGGTTTGTGGATGCCCAGAAGGAAGACATGCCCCCAGAACATGTCAGGAAGATCATT
CGAGACCATGGAGACATGACCAACAGGAAGTTCCGCCATGACAAAAGGGTTTACTTGGGTGCCCTAAAGT
ACATGCCCCACGCAGTCCTCAAACTCCTGGAGAACATGCCTATGCCTTGGGAGCAGATTCGGGATGTGCC
TGTGCTGTACCACATCACTGGAGCCATTTCCTTCGTCAATGAGATTCCCTGGGTCATTGAACCTGTCTAC
ATCTCCCAGTGGGGGTCAATGTGGATTATGATGCGCCGAGAAAAAAGAGATAGGAGGCATTTCAAGAGGA
TGCGTTTTCCCCCTTTTGATGATGAGGAGCCGCCCTTGGACTATGCTGACAACATCCTAGATGTTGAGCC
ACTGGAGGCCATTCAGCTAGAGCTGGACCCTGAGGAGGACGCCCCTGTGTTGGACTGGTTCTATGACCAC
CAGCCGTTGAGGGACAGCAGGAAGTATGTAAATGGCTCCACTTACCAGCGCTGGCAGTTCACACTACCTA
TGATGTCGACTCTCTACCGCCTGGCTAATCAGCTCCTGACAGACTTGGTGGATGACAACTACTTCTACCT
GTTTGATTTGAAGGCCTTCTTTACGTCCAAGGCACTCAATATGGCCATTCCTGGAGGCCCCAAATTTGAA
CCTCTTGTTCGAGACATCAACCTACAGGATGAAGACTGGAATGAATTCAATGATATTAACAAGATTATCA
TCCGGCAGCCTATCCGCACTGAGTACAAGATTGCTTTTCCTTACTTGTACAACAATCTTCCACACCATGT
CCACCTCACCTGGTACCATACTCCCAATGTTGTATTCATCAAAACTGAGGATCCTGACTTGCCAGCTTTC
TACTTTGACCCTTTGATCAACCCAATCTCCCATAGGCACTCAGTCAAGAGCCAGGAACCATTGCCGGATG
ATGATGAGGAATTTGAGCTCCCGGAGTTTGTGGAGCCCTTCCTGAAGGACACACCCCTCTATACAGACAA
TACAGCCAATGGCATTGCCCTGCTCTGGGCCCCGCGGCCCTTCAACCTACGCTCTGGTCGCACCCGTCGG
GCCCTGGACATACCCCTTGTCAAGAACTGGTATCGGGAGCATTGTCCTGCCGGGCAGCCTGTGAAAGTGA
GGGTCTCCTACCAGAAGCTGCTTAAGTACTATGTGCTGAATGCCCTGAAGCATCGGCCCCCTAAGGCTCA
AAAGAAGAGGTATTTGTTCCGCTCCTTCAAAGCCACCAAATTCTTTCAGTCCACAAAGCTGGACTGGGTG
GAGGTTGGGCTCCAGGTTTGCCGCCAGGGCTACAACATGCTCAACCTTCTCATTCACCGCAAAAACCTCA
ACTACCTGCACCTGGACTACAACTTCAACCTCAAGCCTGTGAAAACGCTCACCACCAAGGAAAGAAAGAA
ATCTCGTTTTGGGAATGCTTTCCACCTGTGTCGGGAAGTTCTGCGTTTGACTAAGCTGGTGGTGGATAGT
CACGTGCAGTATCGGCTGGGCAATGTGGATGCCTTCCAGCTGGCAGATGGATTGCAGTATATATTTGCCC
ATGTTGGGCAGTTGACGGGCATGTATCGATACAAATACAAGCTGATGCGACAGATTCGCATGTGCAAGGA
CCTGAAGCATCTCATCTATTATCGTTTCAACACGGGCCCTGTAGGGAAGGGTCCTGGCTGTGGCTTCTGG
GCTGCCGGTTGGCGAGTCTGGCTCTTTTTCATGCGTGGCATTACCCCTTTATTAGAGCGATGGCTTGGCA
ACCTCCTGGCCCGGCAGTTTGAAGGTCGACACTCAAAGGGGGTGGCAAAGACAGTAACAAAGCAGCGAGT
GGAGTCACATTTTGACCTTGAGCTGCGGGCAGCTGTGATGCATGATATTCTGGACATGATGCCTGAGGGG
ATCAAGCAGAACAAGGCCCGGACAATCCTGCAGCACCTCAGTGAAGCCTGGCGCTGCTGGAAAGCCAACA
TTCCCTGGAAGGTCCCTGGGCTGCCGACGCCCATAGAGAATATGATCCTTCGATACGTGAAGGCCAAGGC
TGACTGGTGGACCAACACTGCCCACTACAACCGAGAACGGATCCGCCGAGGGGCCACTGTGGACAAGACT
GTTTGTAAAAAGAATCTGGGCCGCCTCACCCGGCTCTATCTGAAGGCAGAACAGGAGCGGCAGCACAACT
ACCTGAAGGACGGGCCTTACATCACAGCGGAGGAAGCAGTGGCAGTATATACCACCACAGTGCATTGGTT
GGAAAGCCGCAGGTTTTCACCCATCCCATTCCCCCCACTCTCCTATAAGCATGACACCAAGTTGCTCATC
TTGGCATTGGAGCGGCTCAAGGAAGCTTATAGTGTGAAGTCTCGGTTGAACCAGTCTCAGAGGGAGGAGC
TAGGTCTGATCGAGCAGGCCTACGATAACCCCCACGAGGCGCTGTCCCGCATCAAGCGTCACCTCCTCAC
ACAGAGAGCCTTCAAAGAGGTGGGCATTGAGTTCATGGATCTGTATAGCCACCTCGTTCCAGTATATGAT
GTTGAGCCCCTGGAGAAGATAACTGATGCTTACCTGGACCAGTACCTGTGGTATGAAGCCGACAAGCGCC
GCCTGTTCCCACCCTGGATTAAGCCTGCAGACACAGAACCACCTCCGCTGCTTGTTTACAAGTGGTGTCA
AGGCATCAATAACCTGCAGGACGTGTGGGAGACGAGTGAAGGCGAGTGCAATGTCATGCTGGAATCCCGC
TTTGAGAAGATGTATGAGAAGATCGACTTGACTCTGCTCAACAGGCTGCTGCGCCTCATCGTGGACCACA
ACATAGCCGACTACATGACAGCCAAGAACAACGTCGTCATCAACTATAAGGACATGAACCATACGAATTC
ATATGGGATCATCAGAGGCCTGCAGTTTGCCTCATTCATCGTGCAGTATTATGGCCTGGTGATGGATTTG
CTTGTATTGGGATTGCACCGGGCCAGTGAGATGGCTGGGCCCCCTCAGATGCCAAATGACTTTCTCAGTT
TCCAGGACATAGCCACTGAGGCTGCCCACCCCATCCGTCTCTTCTGCAGATACATTGATCGCATCCATAT
TTTTTTCAGGTTCACAGCAGATGAGGCTCGGGACCTGATTCAACGTTACCTGACAGAGCACCCTGACCCC
AATAATGAAAACATCGTTGGCTATAATAACAAGAAGTGCTGGCCCCGAGATGCCCGCATGCGCCTCATGA
AACATGATGTTAACTTAGGCCGGGCGGTATTCTGGGACATCAAGAACCGCTTGCCACGGTCAGTGACTAC
AGTTCAGTGGGAGAACAGCTTCGTGTCTGTGTACAGTAAGGACAACCCCAACCTGCTGTTCAACATGTGT
GGCTTCGAGTGCCGCATCCTGCCTAAGTGCCGCACCAGCTATGAGGAGTTCACCCACAAGGACGGGGTCT
GGAACCTGCAGAATGAGGTTACTAAGGAGCGCACAGCTCAGTGTTTCCTGCGTGTGGACGATGAGTCAAT
GCAGCGCTTCCACAACCGCGTGCGTCAGATTCTCATGGCCTCTGGGTCCACCACCTTCACCAAGATTGTG
AATAAGTGGAATACAGCTCTCATTGGCCTTATGACATACTTTCGGGAGGCTGTGGTGAACACCCAAGAGC
TCTTGGACTTACTGGTGAAGTGTGAGAACAAAATCCAGACACGTATCAAGATTGGACTCAACTCCAAGAT
GCCAAGTCGGTTCCCCCCGGTTGTGTTCTACACCCCTAAGGAGTTGGGTGGACTCGGCATGCTCTCAATG
GGCCATGTGCTCATCCCCCAATCCGACCTCAGGTGGTCCAAACAGACAGATGTAGGTATCACACACTTTC
GTTCAGGAATGAGCCATGAAGAAGACCAGCTCATTCCCAACTTGTACCGCTACATACAGCCATGGGAGAG
CGAGTTCATTGATTCTCAGCGGGTCTGGGCTGAGTACGCACTCAAGAGGCAAGAGGCCATTGCTCAGAAC
AGACGCCTGACTTTAGAAGACCTAGAAGATTCATGGGATCGTGGCATTCCTCGAATCAATACCCTCTTCC
AGAAGGACCGGCACACACTGGCTTATGATAAGGGCTGGCGTGTCAGAACTGACTTTAAGCAGTATCAGGT
TTTGAAGCAGAATCCGTTCTGGTGGACACACCAGCGGCATGATGGGAAGCTCTGGAACCTGAACAACTAC
CGTACAGACATGATCCAGGCCCTGGGCGGTGTGGAAGGCATTCTGGAACACACACTCTTTAAGGGCACTT
ACTTCCCTACCTGGGAGGGGCTTTTCTGGGAGAAGGCCAGTGGCTTTGAGGAATCTATGAAGTGGAAGAA
GCTAACTAATGCTCAGCGATCAGGACTGAACCAGATTCCCAATCGTAGATTCACCCTCTGGTGGTCCCCG
ACCATTAATCGAGCCAATGTATATGTAGGCTTTCAGGTGCAGCTAGACCTGACGGGTATCTTCATGCACG
GCAAGATCCCCACGCTGAAGATCTCTCTCATCCAGATCTTCCGAGCTCACTTGTGGCAGAAGATCCATGA
GAGCATTGTTATGGACTTATGTCAGGTGTTTGACCAGGAACTTGATGCACTGGAAATTGAGACAGTACAA
AAGGAGACAATCCATCCCCGAAAGTCATATAAGATGAACTCTTCCTGTGCAGATATCCTGCTCTTTGCCT
CCTATAAGTGGAATGTCTCCCGGCCCTCATTGCTGGCTGACTCCAAGGATGTGATGGACAGCACCACCAC
CCAGAAATACTGGATTGACATCCAGTTGCGCTGGGGGGACTATGATTCCCACGACATTGAGCGCTACGCC
CGGGCCAAGTTCCTGGACTACACCACCGACAACATGAGTATCTACCCTTCGCCCACAGGTGTACTCATCG
CCATTGACCTGGCCTATAACTTGCACAGTGCCTATGGAAACTGGTTCCCAGGCAGCAAGCCTCTCATACA
ACAGGCCATGGCCAAGATCATGAAGGCAAACCCTGCCCTGTATGTGTTACGTGAACGGATCCGCAAGGGG
CTACAGCTCTATTCATCTGAACCCACTGAGCCTTATTTGTCTTCTCAGAACTATGGTGAGCTCTTCTCCA
ACCAGATTATCTGGTTTGTGGATGACACCAACGTCTACAGAGTGACTATTCACAAGACCTTTGAAGGGAA
CTTGACAACCAAGCCCATCAACGGAGCCATCTTCATCTTCAACCCACGCACAGGGCAGCTGTTCCTCAAG
ATAATCCACACGTCCGTGTGGGCGGGACAGAAGCGTTTGGGGCAGTTGGCTAAGTGGAAGACAGCTGAGG
AGGTGGCCGCCCTGATCCGATCTCTGCCTGTGGAGGAGCAGCCCAAGCAGATCATTGTCACCAGGAAGGG
CATGCTGGACCCACTGGAGGTGCACTTACTGGACTTCCCCAATATTGTCATCAAAGGATCGGAGCTCCAA
CTCCCTTTCCAGGCGTGTCTCAAGGTGGAAAAATTCGGGGATCTCATCCTTAAAGCCACTGAGCCCCAGA
TGGTTCTCTTCAACCTCTATGACGACTGGCTCAAGACTATTTCATCTTACACGGCCTTCTCCCGTCTCAT
CCTGATTCTGCGTGCCCTACATGTGAACAACGATCGGGCAAAAGTGATCCTGAAGCCAGACAAGACTACT
ATTACAGAACCACACCACATCTGGCCCACTCTGACTGACGAAGAATGGATCAAGGTCGAGGTGCAGCTCA
AGGATCTGATCTTGGCTGACTACGGCAAGAAAAACAATGTGAACGTGGCATCACTGACACAATCAGAAAT
TCGAGACATCATCCTGGGTATGGAGATCTCGGCACCGTCACAGCAGCGGCAGCAGATCGCTGAGATCGAG
AAGCAGACCAAGGAACAATCGCAGCTGACGGCAACACAGACTCGCACTGTCAACAAGCATGGCGATGAGA
TCATCACCTCCACCACCAGCAACTATGAGACCCAGACTTTCTCATCCAAGACTGAGTGGAGGGTCAGGGC
CATCTCTGCTGCCAACCTGCACCTAAGGACCAATCACATCTATGTTTCATCTGACGACATCAAGGAGACT
GGCTACACCTACATCCTTCCCAAGAATGTGCTTAAGAAGTTCATCTGCATATCTGACCTTCGGGCCCAAA
TTGCAGGATACCTATATGGGGTGAGCCCACCAGATAACCCCCAGGTGAAGGAGATCCGCTGCATTGTGAT
GGTGCCGCAGTGGGGCACTCACCAGACCGTGCACCTGCCTGGCCAGCTGCCCCAGCATGAGTACCTCAAG
GAGATGGAACCCTTAGGTTGGATCCACACTCAGCCCAATGAGTCCCCGCAGTTATCACCCCAGGATGTCA
CCACCCATGCCAAGATCATGGCTGACAACCCATCTTGGGATGGCGAGAAGACCATTATCATCACATGCAG
CTTCACGCCAGGCTCCTGTACACTGACGGCCTACAAGCTGACCCCCAGTGGCTACGAATGGGGCCGCCAG
AACACAGACAAGGGCAACAACCCCAAGGGCTACCTGCCTTCACACTATGAGAGGGTGCAGATGCTGCTGT
CGGACCGTTTCCTTGGCTTCTTCATGGTCCCTGCCCAGTCCTCGTGGAACTACAACTTCATGGGTGTTCG
GCATGACCCCAACATGAAATATGAGCTACAGCTGGCGAACCCCAAAGAGTTCTACCACGAGGTGCACAGG
CCCTCTCACTTCCTCAACTTTGCTCTCCTGCAGGAGGGGGAGGTTTACTCTGCGGATCGGGAGGACCTGT
ATGCCTGA


>OriGene 5' read for NM_006445 unedited
NGTTAGCATTTGTATACGACTCCTATAGGGCGGCCGCGATTCGGCACGAGGCGGACGCAG
TCTGGCCGCCATTGCGCTGCGGGGAAAGCGGCCTCTTGTGTGAGGGCCTGTGGGATTCTC
CGGATATGGCCGGAGTGTTTCCTTATCGAGGGCCGGGTAACCCGGTGCCTGGCCCTCTAG
CCCCGCTACCGGACTACATGTCGGAGGAGAAGCTGCAGGAGAAAGCTCGAAAATGGCAGC
AATTGCAGGCCAAGCGCTATGCAGAAAAGCGGAAGTTTGGGTTTGTGGATGCCCAGAAGG
AAGACATGCCCCCAGAACATGTCAGGAAGATCATTCGAGACCATGGAGACATGACCAACA
GGAAGTTCCGCCATGACAAAAGGGTTTACTTGGGTGCCCTAAAGTACATGCCCCACGCAG
TCCTCAAACTCCTGGAGAACATGCCTATGCCTTGGGAGCAGATTCGGGATGTGCCTGTGC
TGTACCACATCACTGGAGCCATTTCCTTCGTCAATGAGATTCCCTGNGTCATTGAACCTG
TCTACATCTCCCAGTGGGGGTCAATGTGGATTATGATGCGCCGAGAAAAAAGAGATAGGA
GGCATTTCAAGAGGATGCGTTTTCCCCCTTTTGATGATGAGGAGCCGCCCTTGGACTATG
CTGANCACATCCTAGATGTTGAGCCACTGGAGGCCATTCAGCTAGAGCTGGACCCTNGAG
AGGACGCCCCTGTGTTGGACTGGTTCTATGACCACCAGCCGTTGAGGGNACAGCAGAAGT
ATGTAAATGGCTCCACTTACCAGCGCTGGCAGTTCACACTACCTATGATGTCGACTCTCT
ACCGNCTGGNCTATCAGCTNCTGACAGACTGGNTGGATGACAACTACTNCTACCTGTTNN
GATT
>OriGene 3' read for NM_006445 unedited
CTATGAACCGCGGCCGCAATCTANGATCGAGTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
TTTTTTTTTTTTTTTCCTATTTATACAAAATTTATTATTATATTTTATTCAGGATGACAA
CCCATCAGGAGGTCAACAACCCAACCCCAGACAGAGGGAAAAAGGCCAAACTGCTGAATG
TCACCGGCCTGTCTGGAGGGGCTGAGGCTTCGGCCTCGGGAGGCTGAACCAGGAGGCAGG
GAAACGGTCAGGCATACAGGTCCTCCCGATCCGCAAAGTAAACCTCCCCCTCCTGCAGGA
AACCAAATTTGAGGAAGTGAAAGGGCCTGTCCACCTCGTGGAAAAACTCTTTGGGGTTCC
CCAGCTGTACCTCATATTTCATGTTGGGGTCATGCCAAACACCCATGAAGTTGTATTTCC
ACGAGGACTGGGCAGGGACCATGAAAAACCCAAGGAAACGGTCCGACAGCAGCATCTGCA
CCCTTTAATAGTGTGAAGGCAGGTACCCCTTGGGGTTGTTGCCCTTGTCTGTGTTCTGGC
GGCCCCATTCGTAGCCACTGGGGGTCACCTTGTAGGCCGTCAGTGTACAGGACCCTGGCG
TGAACCTGCATGTGATGATAATGGTCTTCTCGCCATCCCAAGATGGGTTGCCACCCATGA
TCTTGGCATGGGTGGTGACATCCTGGGGTGATAACTGCGGGGACTCATTGGGCTGATTGT
GGATCCAACCTCAGGGTTCCATCTTCCTGAAGAACTCATGCTGGGGCACCTGCCCAGCAA
GTGCCCGTCTTGGAAGTGCCCCATGGGCACCTTACATGCAAGGGATCTCCTTACCTGGGG
GTATTGGGGGGCCCCCCCCATATAGTTCCCGCATTTGGCCCAAGCACAATTCCAATT
Restriction Sites NotI-NotI     
ACCN NM_006445
Insert Size 7140 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_006445.2, NP_006436.2
RefSeq Size 7311 bp
RefSeq ORF 7311 bp
Locus ID 10594
UniProt ID Q6P2Q9
Cytogenetics 17p13.3
Domains JAB_MPN
Protein Families Druggable Genome
Protein Pathways Spliceosome
Gene Summary Pre-mRNA splicing occurs in 2 sequential transesterification steps. The protein encoded by this gene is a component of both U2- and U12-dependent spliceosomes, and found to be essential for the catalytic step II in pre-mRNA splicing process. It contains several WD repeats, which function in protein-protein interactions. This protein has a sequence similarity to yeast Prp8 protein. This gene is a candidate gene for autosomal dominant retinitis pigmentosa. [provided by RefSeq, Jul 2008]

Other Versions

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.