BTG2 (NM_006763) Human Untagged Clone

CAT#: SC115914

BTG2 (untagged)-Human BTG family, member 2 (BTG2)

USD 402.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name BTG2 (NM_006763) Human Untagged Clone
Symbol BTG2
Synonyms APRO1; PC3; TIS21
Vector pCMV6-XL5
Sequence Data
>OriGene ORF within SC115914 sequence for NM_006763 edited (data generated by NextGen Sequencing)
ATGAGCCACGGGAAGGGAACCGACATGCTCCCGGAGATCGCCGCCGCCGTGGGCTTCCTC
TCCAGCCTCCTGAGGACCCGGGGCTGCGTGAGCGAGCAGAGGCTTAAGGTCTTCAGCGGG
GCGCTCCAGGAGGCACTCACAGAGCACTACAAACACCACTGGTTTCCCGAAAAGCCGTCC
AAGGGCTCCGGCTACCGCTGCATTCGCATCAACCACAAGATGGACCCCATCATCAGCAGG
GTGGCCAGCCAGATCGGACTCAGCCAGCCCCAGCTGCACCAGCTGCTGCCCAGCGAGCTG
ACCCTGTGGGTGGACCCCTATGAGGTGTCCTACCGCATTGGGGAGGACGGCTCCATCTGC
GTCTTGTACGAGGAGGCCCCACTGGCCGCCTCCTGTGGGCTCCTCACCTGCAAGAACCAA
GTGCTGCTGGGCCGGAGCAGCCCCTCCAAGAACTACGTGATGGCAGTCTCCAGCTAG

Clone variation with respect to NM_006763.2
>OriGene 5' read for NM_006763 unedited
ATTTGTATACGACTCCTATAGGCGGCCGCGAATTCGGCACGAGGGTAACGCTGTCTTGTG
GACCCGCACTTCCCACCCGAGACCTCTCACTGAGCCCGAGCCGCGCGCGACATGAGCCAC
GGGAAGGGAACCGACATGCTCCCGGAGATCGCCGCCGCCGTGGGCTTCCTCTCCAGCCTC
CTGAGGACCCGGGGCTGCGTGAGCGAGCAGAGGCTTAAGGTCTTCAGCGGGGCGCTCCAG
GAGGCACTCACAGAGCACTACAAACACCACTGGTTTCCCGAAAAGCCGTCCAAGGGCTCC
GGCTACCGCTGCATTCGCATCAACCACAAGATGGACCCCATCATCAGCAGGGTGGCCAGC
CAGATCGGACTCAGCCAGCCCCAGCTGCACCAGCTGCTGCCCAGCGAGCTGACCCTGTGG
GTGGACCCCTATGAGGTGTCCTACCGCATTGGGGAGGACGGCTCCATCTGCGTCTTGTAC
GAGGAGGCCCCACTGGCCGCCTCCTGTGGGCTCCTCACCTGCAAGAACCAAGTGCTGCTG
GGCCGGAGCAGCCCCTCCAAGAACTACGTGATGGCAGTCTCCAGCTAGGCCCTTCCGCCC
CCGCCCTGGGCGCCGCCGTGCTCATGCTGCCGTGACACAGGCCACCACATACCTCAACCT
GNGGAACTGTATTTTTAAATGAAGAGCTATTTATATATATTAATTTTTTTTAAGAAAGGA
GGANAAGAAACCAAAAGTTTTTTTTAAGAAAAAAATNCTTCCAGGGAGCTGCTTGGAAGT
GGCCTCCCCCAGTCCNTTTGGAGAGAACTGTGCGTGCTTGAGTCTGGAGCCAGTGTCTGC
CTATTAGAAGGGGNAGCTGTAGGNGGTAGACCTACCAAGGAGAAGTGGAGACGNTTGGCT
AGCACCCCAGGAGATGTGAAAGGGGAGCAGCAAGGTAGCAACTGTGAACAGAGAGTCCGA
TTTTCCCCTGGTGGAAGAAAATAGGCACTTCAAAT
>OriGene 3' read for NM_006763 unedited
CCGCAATCTAGTGTCGAGTTTTTTTTTTTTTTTTTTATCCTACTACATTTTTATTAAAGT
AACAAAAAGGTGTACATTTGTCCATAAGCTGTACATTCTTCCATATAAAAACACTATCAT
ACAATTAGTAACCTTTGTCTTTTCTGTCAGAATAGCTTACAAACATACTACTACTATTTA
TTTTTACTTAATAGGAGAGACAGGCCTGCTCAACAGTCCAGCTCAGGGGTTTTGTTGTTT
TTAAAGTGAACATCATAAAGAAGAGAAGAGAGACAAGATTAAGCATGAGACCATGAGGCT
GCTTCTAAAAAGGCAGGGACCTGTTTGCAGACAAGATGCAAGAACACAGCCTGCAGTGAT
TCACAGCTTTGTTTCAACCCACAAACCAGAAAATTAGCTCTTGGGTCTGTGGGCCCAAAG
TGAACTTTAAAGCAATAAAGACTGGAAGCAGGTCTGGGAAGGCAATACAAAATGTGGAGA
GTTGAAAAGGAGGCAGAGCTGGCAGGAATGGGTAGGGAGAGTGTTTGGTAAATAGCACCT
TTGAGTCAAAATTGACCAGTTTAAAATCCAGGAAAGGCGACTGGCTGTGGGGAGGATAAC
CTGGGGGTAGAGGAAGTGGGGTGAAAATTCCTTACTTAGGGGCAACCATAGGAGGGTGGC
CATCCTGGCCAAATGCCCTAACCCTGTCCTTCTTTAGGGGATTCGCGTTGGGTAACCCGA
GGGCTTTTCGGGACCCCCTCTTCTTGNCTCTTGAAAATTGGATGGAGGGAGTTTTTTCCA
AGGTAGTTCTCCCTTTTTTCCACCCCCTAAGCGTTTTTGGCCAGGTCTCAACCATTTCGT
TCGGTCGGGTAATACATCCCCTTTCCCACGGTGCTTACTCCCATGATAAAACTTGGCCAG
TGTTGTTCTTTTAGGGGCCCCACCAAACCCAATCCTTTGGCACATGGCCACTTCTCTATC
CATGATTTATATGTTCTCTACTCCCT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_006763
ORF Size 477 bp
Insert Size 2800
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_006763.2, NP_006754
RefSeq Size 2718
RefSeq ORF 477
Locus ID 7832
Cytogenetics 1q32.1
Domains Anti_proliferat
Protein Families Transcription Factors
Gene Summary The protein encoded by this gene is a member of the BTG/Tob family. This family has structurally related proteins that appear to have antiproliferative properties. This encoded protein is involved in the regulation of the G1/S transition of the cell cycle. [provided by RefSeq, Jul 2008].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (2)